Incidental Mutation 'R0305:Specc1l'
ID24906
Institutional Source Beutler Lab
Gene Symbol Specc1l
Ensembl Gene ENSMUSG00000033444
Gene Namesperm antigen with calponin homology and coiled-coil domains 1-like
SynonymsCytsa, Specc1l
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75212073-75312743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75245829 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 353 (V353E)
Ref Sequence ENSEMBL: ENSMUSP00000151322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040105] [ENSMUST00000105421] [ENSMUST00000218766] [ENSMUST00000219387]
Predicted Effect probably damaging
Transcript: ENSMUST00000040105
AA Change: V370E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045099
Gene: ENSMUSG00000033444
AA Change: V370E

DomainStartEndE-ValueType
low complexity region 97 107 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
coiled coil region 255 298 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
coiled coil region 412 467 N/A INTRINSIC
coiled coil region 505 825 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 989 1010 N/A INTRINSIC
CH 1031 1129 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105421
AA Change: V370E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101061
Gene: ENSMUSG00000033444
AA Change: V370E

DomainStartEndE-ValueType
low complexity region 80 90 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
coiled coil region 238 281 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
coiled coil region 395 450 N/A INTRINSIC
coiled coil region 488 808 N/A INTRINSIC
low complexity region 829 841 N/A INTRINSIC
low complexity region 972 993 N/A INTRINSIC
CH 1014 1112 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218766
AA Change: V353E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218876
Predicted Effect probably benign
Transcript: ENSMUST00000219387
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous knockout affects cranial neural crest cell migration, which causes neural tube closure defects and leads to embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Specc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Specc1l APN 10 75246221 missense probably benign 0.12
IGL01638:Specc1l APN 10 75246205 nonsense probably null
IGL01970:Specc1l APN 10 75245761 missense probably damaging 1.00
IGL02539:Specc1l APN 10 75267508 missense probably benign 0.39
IGL02737:Specc1l APN 10 75246324 missense probably damaging 0.99
IGL02941:Specc1l APN 10 75241188 missense probably benign 0.10
R0374:Specc1l UTSW 10 75248459 missense probably damaging 0.99
R0402:Specc1l UTSW 10 75246426 missense probably damaging 1.00
R1456:Specc1l UTSW 10 75246284 missense probably damaging 0.98
R1508:Specc1l UTSW 10 75307238 missense probably benign 0.00
R1861:Specc1l UTSW 10 75309859 missense probably damaging 1.00
R1869:Specc1l UTSW 10 75261825 missense probably damaging 1.00
R1929:Specc1l UTSW 10 75245604 missense probably damaging 1.00
R1930:Specc1l UTSW 10 75309824 missense probably damaging 1.00
R2021:Specc1l UTSW 10 75267591 critical splice donor site probably null
R2209:Specc1l UTSW 10 75246576 missense probably damaging 1.00
R2271:Specc1l UTSW 10 75245604 missense probably damaging 1.00
R2937:Specc1l UTSW 10 75259131 missense probably damaging 0.98
R4415:Specc1l UTSW 10 75246328 missense possibly damaging 0.92
R4758:Specc1l UTSW 10 75246348 missense probably damaging 0.99
R5344:Specc1l UTSW 10 75246173 missense possibly damaging 0.84
R5383:Specc1l UTSW 10 75246705 missense possibly damaging 0.86
R5426:Specc1l UTSW 10 75267550 missense probably benign 0.21
R5774:Specc1l UTSW 10 75245400 missense probably damaging 1.00
R5788:Specc1l UTSW 10 75276921 missense probably damaging 1.00
R6101:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6105:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6136:Specc1l UTSW 10 75246660 missense probably benign 0.38
R6345:Specc1l UTSW 10 75248488 missense probably damaging 0.99
R6459:Specc1l UTSW 10 75246167 missense probably damaging 1.00
R6641:Specc1l UTSW 10 75246549 missense probably damaging 1.00
R6996:Specc1l UTSW 10 75246279 missense probably benign 0.23
R7100:Specc1l UTSW 10 75245495 missense probably benign 0.21
R7475:Specc1l UTSW 10 75246447 missense possibly damaging 0.59
R7545:Specc1l UTSW 10 75245087 missense probably benign 0.00
X0021:Specc1l UTSW 10 75274040 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTTCCCTAGAGCAAAGGCTGGAC -3'
(R):5'- TGACACAGCGACTCCATCAGAATG -3'

Sequencing Primer
(F):5'- AACTATTTGGCTATCAGTCCCTGAG -3'
(R):5'- GTAATCTGCTGGAGATCAGCC -3'
Posted On2013-04-16