Incidental Mutation 'R2418:Acox3'
ID249060
Institutional Source Beutler Lab
Gene Symbol Acox3
Ensembl Gene ENSMUSG00000029098
Gene Nameacyl-Coenzyme A oxidase 3, pristanoyl
SynonymsEST-s59, pristanoyl-CoA oxidase, PCOX
MMRRC Submission 040380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R2418 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location35583040-35615352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35604638 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 442 (N442S)
Ref Sequence ENSEMBL: ENSMUSP00000144499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068563] [ENSMUST00000068947] [ENSMUST00000114237] [ENSMUST00000114238] [ENSMUST00000202266]
Predicted Effect probably benign
Transcript: ENSMUST00000068563
AA Change: N442S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000067178
Gene: ENSMUSG00000029098
AA Change: N442S

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 3e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 6e-9 PFAM
Pfam:ACOX 507 662 5.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068947
AA Change: N442S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000063412
Gene: ENSMUSG00000029098
AA Change: N442S

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 8.7e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 5.5e-8 PFAM
Pfam:ACOX 510 690 6.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114237
AA Change: N442S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109875
Gene: ENSMUSG00000029098
AA Change: N442S

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 5.7e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 9.4e-9 PFAM
Pfam:ACOX 507 695 1.6e-50 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114238
AA Change: N442S
SMART Domains Protein: ENSMUSP00000109876
Gene: ENSMUSG00000029098
AA Change: N442S

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 198 309 1.4e-17 PFAM
Pfam:Acyl-CoA_dh_1 340 509 1.3e-7 PFAM
Pfam:ACOX 553 707 1.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154796
Predicted Effect unknown
Transcript: ENSMUST00000201106
AA Change: N8S
Predicted Effect probably benign
Transcript: ENSMUST00000202266
AA Change: N442S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144499
Gene: ENSMUSG00000029098
AA Change: N442S

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 4.5e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 3.2e-8 PFAM
Pfam:ACOX 510 667 1.6e-45 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acp5 C A 9: 22,129,952 V60L probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Btd G A 14: 31,641,136 probably null Het
Cfap74 T A 4: 155,455,709 probably benign Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Col4a4 G T 1: 82,532,936 A205E unknown Het
Cwf19l1 T C 19: 44,131,472 T77A probably benign Het
Cyp2b9 A G 7: 26,186,707 T100A probably benign Het
Ddx24 A G 12: 103,417,737 L485P probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dnase1l3 T A 14: 7,968,089 E272V possibly damaging Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Elk3 T C 10: 93,284,827 N50S probably damaging Het
Fmo3 A T 1: 162,966,958 I181K probably benign Het
Golga3 T C 5: 110,201,868 I655T probably damaging Het
Hspa1l A T 17: 34,977,188 T68S probably benign Het
Itgax C T 7: 128,142,333 R839W probably damaging Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Kmt5b C T 19: 3,807,266 A318V probably benign Het
Krt78 T C 15: 101,946,634 Y914C probably benign Het
Lactb2 T C 1: 13,660,339 T38A possibly damaging Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Magi1 T C 6: 93,745,910 D329G probably damaging Het
Map3k5 T A 10: 20,110,857 V939E probably benign Het
Mcm8 C T 2: 132,824,738 A233V probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Mical2 G T 7: 112,320,734 probably null Het
Nudt13 A G 14: 20,311,513 E219G probably damaging Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr449 A G 6: 42,838,049 H56R probably benign Het
Olfr653 A T 7: 104,579,934 H96L probably benign Het
Osbpl7 A C 11: 97,059,178 D395A probably benign Het
Osbpl9 A G 4: 109,066,218 C495R probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Pcnx4 T A 12: 72,556,263 F433Y probably damaging Het
Pdp1 G A 4: 11,961,838 P158S probably damaging Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Ptbp1 T C 10: 79,859,677 Y187H probably damaging Het
Resp18 T C 1: 75,272,311 *176W probably null Het
Rps6ka2 A C 17: 7,299,339 Q665H possibly damaging Het
Rtn1 T C 12: 72,304,278 T386A probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Scn1a T C 2: 66,273,843 N1663S probably damaging Het
Smyd1 A T 6: 71,239,553 I70N probably damaging Het
Tas2r105 T C 6: 131,687,447 E6G probably damaging Het
Tchh G T 3: 93,445,629 R792L unknown Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem184b A G 15: 79,365,943 Y211H possibly damaging Het
Top3a C A 11: 60,748,016 G551V possibly damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Wdr66 A C 5: 123,254,268 probably benign Het
Other mutations in Acox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Acox3 APN 5 35588752 missense probably benign 0.02
IGL02118:Acox3 APN 5 35601521 missense possibly damaging 0.55
IGL02554:Acox3 APN 5 35608366 missense probably damaging 1.00
IGL03377:Acox3 APN 5 35594332 missense probably damaging 1.00
R1543:Acox3 UTSW 5 35603008 missense probably damaging 1.00
R1661:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1665:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1707:Acox3 UTSW 5 35601564 missense possibly damaging 0.87
R1725:Acox3 UTSW 5 35592172 missense probably benign 0.26
R1763:Acox3 UTSW 5 35608339 unclassified probably null
R1851:Acox3 UTSW 5 35609062 missense possibly damaging 0.72
R1923:Acox3 UTSW 5 35592115 missense possibly damaging 0.80
R2154:Acox3 UTSW 5 35605224 missense probably damaging 1.00
R2892:Acox3 UTSW 5 35594317 missense probably damaging 1.00
R2893:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2894:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2964:Acox3 UTSW 5 35605267 missense possibly damaging 0.81
R3431:Acox3 UTSW 5 35589216 missense possibly damaging 0.47
R3735:Acox3 UTSW 5 35611153 missense probably benign 0.02
R3736:Acox3 UTSW 5 35611153 missense probably benign 0.02
R4106:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4107:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4108:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4579:Acox3 UTSW 5 35604643 missense probably damaging 1.00
R4862:Acox3 UTSW 5 35589739 missense probably benign 0.22
R4903:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4949:Acox3 UTSW 5 35612106 missense probably benign 0.06
R4964:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4966:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R5170:Acox3 UTSW 5 35588625 missense probably benign 0.42
R5278:Acox3 UTSW 5 35588156 splice site probably benign
R5569:Acox3 UTSW 5 35603033 missense probably damaging 1.00
R5733:Acox3 UTSW 5 35605199 splice site probably null
R5741:Acox3 UTSW 5 35608324 missense probably benign 0.07
R6530:Acox3 UTSW 5 35588695 missense possibly damaging 0.65
R6580:Acox3 UTSW 5 35608403 missense probably damaging 1.00
R6736:Acox3 UTSW 5 35588854 critical splice donor site probably null
R6848:Acox3 UTSW 5 35592184 missense probably damaging 1.00
R7012:Acox3 UTSW 5 35612087 missense probably benign 0.14
Z1088:Acox3 UTSW 5 35588222 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGACAATCCTCACTGCCAC -3'
(R):5'- GACCACAAGCTTGGATCTCC -3'

Sequencing Primer
(F):5'- GAATGTTCATGTGTCATCCCAAAGC -3'
(R):5'- TGGATCTCCCAAAGCCTGAGAG -3'
Posted On2014-11-12