Incidental Mutation 'R2418:Klkb1'
ID249077
Institutional Source Beutler Lab
Gene Symbol Klkb1
Ensembl Gene ENSMUSG00000109764
Gene Namekallikrein B, plasma 1
SynonymsKlk3, Kal-3, PSA, Kal3
MMRRC Submission 040380-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R2418 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45266689-45294859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45289112 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 43 (D43E)
Ref Sequence ENSEMBL: ENSMUSP00000026907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026907
AA Change: D43E

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026907
Gene: ENSMUSG00000109764
AA Change: D43E

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116473
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric enzyme comprised of heavy and light chains. A complete deletion of the encoded protein prevents occlusive thrombus formation in mice with a minimal role in provoked bleeding. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced hematoma expansion in streptozotocin-induced diabetic mice subjected to autologous blood injection, and prolonged activated partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acox3 A G 5: 35,604,638 N442S probably benign Het
Acp5 C A 9: 22,129,952 V60L probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Btd G A 14: 31,641,136 probably null Het
Cfap74 T A 4: 155,455,709 probably benign Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Col4a4 G T 1: 82,532,936 A205E unknown Het
Cwf19l1 T C 19: 44,131,472 T77A probably benign Het
Cyp2b9 A G 7: 26,186,707 T100A probably benign Het
Ddx24 A G 12: 103,417,737 L485P probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dnase1l3 T A 14: 7,968,089 E272V possibly damaging Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Elk3 T C 10: 93,284,827 N50S probably damaging Het
Fmo3 A T 1: 162,966,958 I181K probably benign Het
Golga3 T C 5: 110,201,868 I655T probably damaging Het
Hspa1l A T 17: 34,977,188 T68S probably benign Het
Itgax C T 7: 128,142,333 R839W probably damaging Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Kmt5b C T 19: 3,807,266 A318V probably benign Het
Krt78 T C 15: 101,946,634 Y914C probably benign Het
Lactb2 T C 1: 13,660,339 T38A possibly damaging Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Magi1 T C 6: 93,745,910 D329G probably damaging Het
Map3k5 T A 10: 20,110,857 V939E probably benign Het
Mcm8 C T 2: 132,824,738 A233V probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Mical2 G T 7: 112,320,734 probably null Het
Nudt13 A G 14: 20,311,513 E219G probably damaging Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr449 A G 6: 42,838,049 H56R probably benign Het
Olfr653 A T 7: 104,579,934 H96L probably benign Het
Osbpl7 A C 11: 97,059,178 D395A probably benign Het
Osbpl9 A G 4: 109,066,218 C495R probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Pcnx4 T A 12: 72,556,263 F433Y probably damaging Het
Pdp1 G A 4: 11,961,838 P158S probably damaging Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Ptbp1 T C 10: 79,859,677 Y187H probably damaging Het
Resp18 T C 1: 75,272,311 *176W probably null Het
Rps6ka2 A C 17: 7,299,339 Q665H possibly damaging Het
Rtn1 T C 12: 72,304,278 T386A probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Scn1a T C 2: 66,273,843 N1663S probably damaging Het
Smyd1 A T 6: 71,239,553 I70N probably damaging Het
Tas2r105 T C 6: 131,687,447 E6G probably damaging Het
Tchh G T 3: 93,445,629 R792L unknown Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem184b A G 15: 79,365,943 Y211H possibly damaging Het
Top3a C A 11: 60,748,016 G551V possibly damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Wdr66 A C 5: 123,254,268 probably benign Het
Other mutations in Klkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Klkb1 APN 8 45294068 splice site probably benign
IGL01756:Klkb1 APN 8 45272324 missense probably damaging 0.99
IGL01783:Klkb1 APN 8 45276391 missense probably damaging 1.00
IGL01809:Klkb1 APN 8 45276053 missense probably benign 0.00
IGL02128:Klkb1 APN 8 45287031 missense probably damaging 1.00
IGL02512:Klkb1 APN 8 45276240 splice site probably benign
E0374:Klkb1 UTSW 8 45289091 missense possibly damaging 0.58
R0048:Klkb1 UTSW 8 45289196 splice site probably benign
R0149:Klkb1 UTSW 8 45276063 missense probably damaging 1.00
R0278:Klkb1 UTSW 8 45272409 missense probably benign 0.27
R0551:Klkb1 UTSW 8 45277966 critical splice donor site probably null
R1103:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1420:Klkb1 UTSW 8 45276146 missense probably damaging 1.00
R1930:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R1931:Klkb1 UTSW 8 45275477 missense probably benign 0.13
R2125:Klkb1 UTSW 8 45275504 missense possibly damaging 0.68
R2419:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R3938:Klkb1 UTSW 8 45282801 missense probably damaging 0.99
R4445:Klkb1 UTSW 8 45277055 missense probably benign 0.11
R4461:Klkb1 UTSW 8 45273575 missense probably damaging 1.00
R4969:Klkb1 UTSW 8 45282777 missense probably benign 0.43
R4974:Klkb1 UTSW 8 45286958 missense probably damaging 1.00
R5113:Klkb1 UTSW 8 45270697 missense probably benign 0.00
R5117:Klkb1 UTSW 8 45289112 missense possibly damaging 0.86
R5339:Klkb1 UTSW 8 45270711 missense possibly damaging 0.93
R5891:Klkb1 UTSW 8 45270666 missense probably benign 0.13
R6230:Klkb1 UTSW 8 45283215 missense probably benign 0.03
R6554:Klkb1 UTSW 8 45273554 missense probably damaging 1.00
R6564:Klkb1 UTSW 8 45273634 missense probably damaging 0.98
R7130:Klkb1 UTSW 8 45275538 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCCTAGGAGCTTCTGATG -3'
(R):5'- AGACCCGTGAAGTTGTAATGAC -3'

Sequencing Primer
(F):5'- CCTAGGAGCTTCTGATGCAAAG -3'
(R):5'- CCCGTGAAGTTGTAATGACTATTAGG -3'
Posted On2014-11-12