Incidental Mutation 'R0305:Slc39a5'
ID24909
Institutional Source Beutler Lab
Gene Symbol Slc39a5
Ensembl Gene ENSMUSG00000039878
Gene Namesolute carrier family 39 (metal ion transporter), member 5
SynonymsZip5, 2010205A06Rik, 1810013D05Rik
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128395931-128401229 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 128398396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014642] [ENSMUST00000026439] [ENSMUST00000042666] [ENSMUST00000164199] [ENSMUST00000164664] [ENSMUST00000166608] [ENSMUST00000167859] [ENSMUST00000172348] [ENSMUST00000218858] [ENSMUST00000219131]
Predicted Effect probably benign
Transcript: ENSMUST00000014642
SMART Domains Protein: ENSMUSP00000014642
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 7 36 4.44e2 SMART
ANK 40 69 6.55e-5 SMART
ANK 73 102 1.03e-2 SMART
ANK 106 135 1.5e1 SMART
ANK 139 168 5.49e-7 SMART
ANK 172 201 3.01e-4 SMART
ANK 205 234 1.2e-3 SMART
ANK 238 267 2.62e-4 SMART
ANK 271 301 9.78e-4 SMART
ANK 305 334 3.85e-2 SMART
ANK 338 367 5.62e-4 SMART
ANK 371 402 1.55e2 SMART
ANK 422 451 2.16e-5 SMART
ANK 455 484 3.28e-5 SMART
ANK 488 545 2.79e1 SMART
ANK 549 578 5.45e-2 SMART
ANK 584 613 1.84e1 SMART
ANK 617 646 3.85e-2 SMART
ANK 651 682 2.1e-3 SMART
ANK 687 716 6.76e-7 SMART
ANK 720 749 1.07e0 SMART
ANK 753 784 2.92e-2 SMART
ANK 790 819 1.12e-3 SMART
ANK 822 853 9.75e1 SMART
ANK 857 886 1.99e-4 SMART
ANK 890 920 5.09e-2 SMART
ANK 924 953 2.54e-2 SMART
ANK 960 989 1.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026439
SMART Domains Protein: ENSMUSP00000026439
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042666
SMART Domains Protein: ENSMUSP00000037753
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 2.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164199
SMART Domains Protein: ENSMUSP00000128634
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164664
SMART Domains Protein: ENSMUSP00000127605
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 5.8e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166608
SMART Domains Protein: ENSMUSP00000131171
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 39 120 4.2e-9 PFAM
low complexity region 147 164 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 201 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167456
Predicted Effect probably benign
Transcript: ENSMUST00000167859
SMART Domains Protein: ENSMUSP00000131736
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172348
SMART Domains Protein: ENSMUSP00000127015
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 6.1e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179358
Predicted Effect probably benign
Transcript: ENSMUST00000218858
Predicted Effect probably benign
Transcript: ENSMUST00000219131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219222
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ZIP family of zinc transporters that transport zinc into cells from outside, and play a crucial role in controlling intracellular zinc levels. Zinc is an essential cofactor for many enzymes and proteins involved in gene transcription, growth, development and differentiation. Mutations in this gene have been associated with autosomal dominant high myopia (MYP24). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered zinc homeostasis and increased susceptibility to zinc-induced pancretitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Slc39a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:Slc39a5 APN 10 128399330 missense probably benign 0.00
IGL02666:Slc39a5 APN 10 128398455 missense probably damaging 1.00
R0350:Slc39a5 UTSW 10 128396750 critical splice donor site probably null
R0437:Slc39a5 UTSW 10 128399847 missense possibly damaging 0.94
R1401:Slc39a5 UTSW 10 128397741 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398410 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398411 missense probably damaging 1.00
R2286:Slc39a5 UTSW 10 128396060 missense probably benign 0.00
R4041:Slc39a5 UTSW 10 128396468 missense possibly damaging 0.95
R4649:Slc39a5 UTSW 10 128397267 missense probably benign 0.00
R4776:Slc39a5 UTSW 10 128397049 missense probably damaging 0.98
R4890:Slc39a5 UTSW 10 128398447 missense probably benign 0.13
R5911:Slc39a5 UTSW 10 128399943 missense probably damaging 1.00
R6703:Slc39a5 UTSW 10 128397782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGAGGATGGAGGTTCACATAC -3'
(R):5'- TGGTCAATTTTGGACTGAGCCCTG -3'

Sequencing Primer
(F):5'- CAGATACATACACTCACGGGAG -3'
(R):5'- GACTGAGCCCTGTTGCTCC -3'
Posted On2013-04-16