Incidental Mutation 'R2419:1700022I11Rik'
ID249128
Institutional Source Beutler Lab
Gene Symbol 1700022I11Rik
Ensembl Gene ENSMUSG00000028451
Gene NameRIKEN cDNA 1700022I11 gene
Synonyms
MMRRC Submission 040381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.031) question?
Stock #R2419 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location42969604-42983640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42974146 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1160 (T1160A)
Ref Sequence ENSEMBL: ENSMUSP00000030163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030163] [ENSMUST00000139127] [ENSMUST00000185904] [ENSMUST00000190902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030163
AA Change: T1160A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030163
Gene: ENSMUSG00000028451
AA Change: T1160A

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
internal_repeat_1 322 432 6.53e-5 PROSPERO
low complexity region 434 449 N/A INTRINSIC
low complexity region 507 521 N/A INTRINSIC
low complexity region 599 610 N/A INTRINSIC
internal_repeat_1 622 738 6.53e-5 PROSPERO
low complexity region 847 861 N/A INTRINSIC
low complexity region 897 908 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 944 958 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185904
SMART Domains Protein: ENSMUSP00000140492
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:FAM75 99 149 2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189414
Predicted Effect probably benign
Transcript: ENSMUST00000190902
SMART Domains Protein: ENSMUSP00000140363
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acyp2 T C 11: 30,632,316 Y33C probably benign Het
Ampd3 A G 7: 110,768,369 probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Arl4d A T 11: 101,666,888 Q80L probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Ccdc38 T A 10: 93,548,975 V35D probably benign Het
Cd6 G A 19: 10,792,852 P492S probably damaging Het
Cdh20 G A 1: 104,975,015 S477N possibly damaging Het
Cnmd G A 14: 79,638,048 P311S probably damaging Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Dusp18 T C 11: 3,897,018 S3P possibly damaging Het
Eml2 A G 7: 19,176,695 probably benign Het
Foxb2 G C 19: 16,872,961 A227G probably damaging Het
Hey1 A G 3: 8,665,943 probably null Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kcna2 G A 3: 107,104,153 G17R probably benign Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Leng9 A G 7: 4,148,627 V350A probably benign Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Lrat A G 3: 82,903,685 S10P probably damaging Het
Lrrk2 C A 15: 91,797,526 probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Met T C 6: 17,535,830 probably benign Het
Mical3 A G 6: 120,959,923 V342A probably benign Het
Nup210 G A 6: 91,017,556 probably benign Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr1357 T A 10: 78,612,387 I85F probably benign Het
Olfr340 T A 2: 36,453,326 V247E probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Phc3 T C 3: 30,950,878 M189V probably damaging Het
Plcb1 A G 2: 135,262,100 probably benign Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Rbbp5 T C 1: 132,493,826 I88T possibly damaging Het
Rfpl4b T C 10: 38,821,372 R78G probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Sdad1 T C 5: 92,305,818 H37R possibly damaging Het
Setd2 T A 9: 110,548,997 F627I possibly damaging Het
Ski A G 4: 155,160,893 S293P probably benign Het
Slc27a1 A G 8: 71,579,916 E191G possibly damaging Het
Snx18 T C 13: 113,617,219 M393V possibly damaging Het
Tacc1 A G 8: 25,182,813 V42A possibly damaging Het
Tbc1d8 A G 1: 39,376,902 F897L probably damaging Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem62 G A 2: 121,007,105 G501E probably damaging Het
Tmem94 A G 11: 115,796,815 K1167E probably damaging Het
Trap1 A G 16: 4,068,330 S88P probably benign Het
Ugt2b38 T C 5: 87,423,732 D147G probably damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Zcchc14 T A 8: 121,603,936 Q896L probably damaging Het
Zfp619 A G 7: 39,535,883 K446E possibly damaging Het
Zpr1 T C 9: 46,276,192 probably benign Het
Other mutations in 1700022I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:1700022I11Rik APN 4 42973982 missense probably benign 0.40
IGL01340:1700022I11Rik APN 4 42971984 missense possibly damaging 0.94
IGL02078:1700022I11Rik APN 4 42972685 missense possibly damaging 0.71
IGL02082:1700022I11Rik APN 4 42970198 missense probably benign 0.00
IGL02993:1700022I11Rik APN 4 42971719 missense probably damaging 0.99
IGL03174:1700022I11Rik APN 4 42970975 missense probably benign 0.00
IGL03188:1700022I11Rik APN 4 42971225 missense possibly damaging 0.56
R0031:1700022I11Rik UTSW 4 42973712 missense probably damaging 0.99
R0179:1700022I11Rik UTSW 4 42972214 missense probably benign 0.00
R0409:1700022I11Rik UTSW 4 42972203 missense probably damaging 0.98
R0422:1700022I11Rik UTSW 4 42972199 missense possibly damaging 0.95
R0462:1700022I11Rik UTSW 4 42973429 missense probably benign
R0467:1700022I11Rik UTSW 4 42972715 missense probably benign
R0677:1700022I11Rik UTSW 4 42970952 nonsense probably null
R0723:1700022I11Rik UTSW 4 42971691 missense probably damaging 0.98
R1479:1700022I11Rik UTSW 4 42972543 missense possibly damaging 0.55
R1586:1700022I11Rik UTSW 4 42971512 missense probably benign 0.03
R1956:1700022I11Rik UTSW 4 42970105 splice site probably null
R2030:1700022I11Rik UTSW 4 42974131 nonsense probably null
R2074:1700022I11Rik UTSW 4 42974171 missense probably benign 0.38
R2162:1700022I11Rik UTSW 4 42972238 missense possibly damaging 0.59
R2939:1700022I11Rik UTSW 4 42972946 missense probably benign 0.04
R3615:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3616:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3981:1700022I11Rik UTSW 4 42971534 missense probably damaging 0.99
R5037:1700022I11Rik UTSW 4 42972195 missense probably benign
R5252:1700022I11Rik UTSW 4 42971706 missense probably benign 0.00
R5526:1700022I11Rik UTSW 4 42972125 missense possibly damaging 0.90
R5642:1700022I11Rik UTSW 4 42971831 missense possibly damaging 0.61
R5935:1700022I11Rik UTSW 4 42971465 missense probably benign
R6082:1700022I11Rik UTSW 4 42972511 missense probably benign 0.27
R6136:1700022I11Rik UTSW 4 42972853 missense probably damaging 0.96
R6361:1700022I11Rik UTSW 4 42972695 missense probably benign 0.05
R6494:1700022I11Rik UTSW 4 42971924 missense possibly damaging 0.94
R6641:1700022I11Rik UTSW 4 42971245 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCTCAGAGTTCCCCACATTC -3'
(R):5'- GGTTACTCTGCTCACTCCAG -3'

Sequencing Primer
(F):5'- ACATTCGGCCCTTGCTCAG -3'
(R):5'- CATTACAGGTAGTTGTGAGCCACC -3'
Posted On2014-11-12