Incidental Mutation 'R2419:Eml2'
ID249137
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Nameechinoderm microtubule associated protein like 2
Synonyms1600029N02Rik
MMRRC Submission 040381-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2419 (G1)
Quality Score181
Status Validated
Chromosome7
Chromosomal Location19176421-19206482 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 19176695 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000141718] [ENSMUST00000144054] [ENSMUST00000148246]
Predicted Effect probably benign
Transcript: ENSMUST00000048502
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083609
Predicted Effect unknown
Transcript: ENSMUST00000117338
AA Change: M28V
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: M28V

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120595
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141792
Predicted Effect probably benign
Transcript: ENSMUST00000144054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146095
Predicted Effect probably benign
Transcript: ENSMUST00000148246
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,974,146 T1160A possibly damaging Het
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acyp2 T C 11: 30,632,316 Y33C probably benign Het
Ampd3 A G 7: 110,768,369 probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Arl4d A T 11: 101,666,888 Q80L probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Ccdc38 T A 10: 93,548,975 V35D probably benign Het
Cd6 G A 19: 10,792,852 P492S probably damaging Het
Cdh20 G A 1: 104,975,015 S477N possibly damaging Het
Cnmd G A 14: 79,638,048 P311S probably damaging Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Dusp18 T C 11: 3,897,018 S3P possibly damaging Het
Foxb2 G C 19: 16,872,961 A227G probably damaging Het
Hey1 A G 3: 8,665,943 probably null Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kcna2 G A 3: 107,104,153 G17R probably benign Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Leng9 A G 7: 4,148,627 V350A probably benign Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Lrat A G 3: 82,903,685 S10P probably damaging Het
Lrrk2 C A 15: 91,797,526 probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Met T C 6: 17,535,830 probably benign Het
Mical3 A G 6: 120,959,923 V342A probably benign Het
Nup210 G A 6: 91,017,556 probably benign Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr1357 T A 10: 78,612,387 I85F probably benign Het
Olfr340 T A 2: 36,453,326 V247E probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Phc3 T C 3: 30,950,878 M189V probably damaging Het
Plcb1 A G 2: 135,262,100 probably benign Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Rbbp5 T C 1: 132,493,826 I88T possibly damaging Het
Rfpl4b T C 10: 38,821,372 R78G probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Sdad1 T C 5: 92,305,818 H37R possibly damaging Het
Setd2 T A 9: 110,548,997 F627I possibly damaging Het
Ski A G 4: 155,160,893 S293P probably benign Het
Slc27a1 A G 8: 71,579,916 E191G possibly damaging Het
Snx18 T C 13: 113,617,219 M393V possibly damaging Het
Tacc1 A G 8: 25,182,813 V42A possibly damaging Het
Tbc1d8 A G 1: 39,376,902 F897L probably damaging Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem62 G A 2: 121,007,105 G501E probably damaging Het
Tmem94 A G 11: 115,796,815 K1167E probably damaging Het
Trap1 A G 16: 4,068,330 S88P probably benign Het
Ugt2b38 T C 5: 87,423,732 D147G probably damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Zcchc14 T A 8: 121,603,936 Q896L probably damaging Het
Zfp619 A G 7: 39,535,883 K446E possibly damaging Het
Zpr1 T C 9: 46,276,192 probably benign Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 unclassified probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 unclassified probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCTCTCGACACCCTTACAGG -3'
(R):5'- GGGTCAGAATCCTGTTGATGAG -3'

Sequencing Primer
(F):5'- TTACAGGGCATCCTAGGGG -3'
(R):5'- TCAGAATCCTGTTGATGAGGAGAAAG -3'
Posted On2014-11-12