Mutagenetix > Incidental Mutation

Incidental Mutation 'R2419:Zpr1'

249148

Institutional Source

Beutler Lab

Gene Symbol

Zpr1

Ensembl Gene

ENSMUSG00000032078

Gene Name

ZPR1 zinc finger

Synonyms

Zfp259, ZPR1

MMRRC Submission

040381-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2419 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46184362-46193941 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 46187490 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440]

AlphaFold

Q62384

PDB Structure

Crystal structure of tandem ZPR1 domains [X-RAY DIFFRACTION]

Predicted Effect

SMART Domains

Protein: ENSMUSP00000034583
Gene: ENSMUSG00000032078

Domain	Start	End	E-Value	Type
low complexity region	9	30	N/A	INTRINSIC
Zpr1	49	207	1.47e-93	SMART
low complexity region	236	246	N/A	INTRINSIC
Zpr1	257	387	1.56e-65	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000034584

SMART Domains

Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079

Domain	Start	End	E-Value	Type
Pfam:Apolipoprotein	52	264	5.1e-59	PFAM
Pfam:Apolipoprotein	258	315	1.8e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114552

SMART Domains

Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

Domain	Start	End	E-Value	Type
Zpr1	12	150	5.57e-30	SMART
Zpr1	184	343	4.27e-90	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121598

SMART Domains

Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079

Domain	Start	End	E-Value	Type
Pfam:Apolipoprotein	51	305	8.1e-66	PFAM
low complexity region	312	323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125239

SMART Domains

Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

Domain	Start	End	E-Value	Type
low complexity region	11	32	N/A	INTRINSIC
Blast:Zpr1	33	59	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125791

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141763

Predicted Effect

probably benign
Transcript: ENSMUST00000156440

SMART Domains

Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

Domain	Start	End	E-Value	Type
low complexity region	9	30	N/A	INTRINSIC
Zpr1	49	207	1.47e-93	SMART
low complexity region	236	246	N/A	INTRINSIC
Zpr1	257	416	4.27e-90	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215484

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the cytoplasm of quiescent cells but translocates to the nucleolus in proliferating cells. The encoded protein interacts with survival motor neuron protein (SMN1) to enhance pre-mRNA splicing and to induce neuronal differentiation and axonal growth. Defects in this gene or the SMN1 gene can cause spinal muscular atrophy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to form a normal trophectoderm and fail to expand the inner cell mass. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	G	A	2: 25,328,001 (GRCm39)	A768T	probably benign	Het
Acyp2	T	C	11: 30,582,316 (GRCm39)	Y33C	probably benign	Het
Ampd3	A	G	7: 110,367,576 (GRCm39)		probably benign	Het
Arap3	T	C	18: 38,122,997 (GRCm39)	D501G	probably damaging	Het
Arl4d	A	T	11: 101,557,714 (GRCm39)	Q80L	probably damaging	Het
Bcorl1	A	G	X: 47,459,418 (GRCm39)	T425A	probably damaging	Het
Ccdc38	T	A	10: 93,384,837 (GRCm39)	V35D	probably benign	Het
Cd6	G	A	19: 10,770,216 (GRCm39)	P492S	probably damaging	Het
Cdh20	G	A	1: 104,902,740 (GRCm39)	S477N	possibly damaging	Het
Cnmd	G	A	14: 79,875,488 (GRCm39)	P311S	probably damaging	Het
Cnot8	G	A	11: 58,006,136 (GRCm39)	G222R	probably damaging	Het
Dnah9	A	T	11: 65,986,241 (GRCm39)	L1131*	probably null	Het
Dscc1	G	A	15: 54,946,820 (GRCm39)	R302*	probably null	Het
Dusp18	T	C	11: 3,847,018 (GRCm39)	S3P	possibly damaging	Het
Eml2	A	G	7: 18,910,620 (GRCm39)		probably benign	Het
Foxb2	G	C	19: 16,850,325 (GRCm39)	A227G	probably damaging	Het
Hey1	A	G	3: 8,731,003 (GRCm39)		probably null	Het
Itk	A	G	11: 46,229,044 (GRCm39)	F379L	probably damaging	Het
Kcna2	G	A	3: 107,011,469 (GRCm39)	G17R	probably benign	Het
Kif7	C	A	7: 79,348,441 (GRCm39)	R1300L	probably benign	Het
Klkb1	A	T	8: 45,742,149 (GRCm39)	D43E	possibly damaging	Het
Leng9	A	G	7: 4,151,626 (GRCm39)	V350A	probably benign	Het
Lmbr1l	A	C	15: 98,805,418 (GRCm39)	F361C	possibly damaging	Het
Lrat	A	G	3: 82,810,992 (GRCm39)	S10P	probably damaging	Het
Lrrk2	C	A	15: 91,681,729 (GRCm39)		probably benign	Het
Mcur1	C	T	13: 43,703,013 (GRCm39)	V241M	possibly damaging	Het
Met	T	C	6: 17,535,829 (GRCm39)		probably benign	Het
Mical3	A	G	6: 120,936,884 (GRCm39)	V342A	probably benign	Het
Nup210	G	A	6: 90,994,538 (GRCm39)		probably benign	Het
Or1i2	T	A	10: 78,448,221 (GRCm39)	I85F	probably benign	Het
Or1j12	T	A	2: 36,343,338 (GRCm39)	V247E	probably damaging	Het
Or4c107	A	G	2: 88,789,380 (GRCm39)	N190S	probably benign	Het
Pcdhac1	T	C	18: 37,224,381 (GRCm39)	L398P	probably benign	Het
Phc3	T	C	3: 31,005,027 (GRCm39)	M189V	probably damaging	Het
Plcb1	A	G	2: 135,104,020 (GRCm39)		probably benign	Het
Plcxd3	G	T	15: 4,604,245 (GRCm39)	K284N	probably benign	Het
Plxnb2	A	G	15: 89,045,272 (GRCm39)	V1058A	possibly damaging	Het
Rbbp5	T	C	1: 132,421,564 (GRCm39)	I88T	possibly damaging	Het
Rfpl4b	T	C	10: 38,697,368 (GRCm39)	R78G	probably benign	Het
Rsf1	CG	CGACGGCGGGG	7: 97,229,115 (GRCm39)		probably benign	Het
Samt2	A	T	X: 153,358,223 (GRCm39)		probably null	Het
Sdad1	T	C	5: 92,453,677 (GRCm39)	H37R	possibly damaging	Het
Setd2	T	A	9: 110,378,065 (GRCm39)	F627I	possibly damaging	Het
Ski	A	G	4: 155,245,350 (GRCm39)	S293P	probably benign	Het
Slc27a1	A	G	8: 72,032,560 (GRCm39)	E191G	possibly damaging	Het
Snx18	T	C	13: 113,753,755 (GRCm39)	M393V	possibly damaging	Het
Spata31g1	A	G	4: 42,974,146 (GRCm39)	T1160A	possibly damaging	Het
Tacc1	A	G	8: 25,672,829 (GRCm39)	V42A	possibly damaging	Het
Tbc1d8	A	G	1: 39,415,983 (GRCm39)	F897L	probably damaging	Het
Tenm3	C	T	8: 48,729,693 (GRCm39)	D1438N	possibly damaging	Het
Tmem62	G	A	2: 120,837,586 (GRCm39)	G501E	probably damaging	Het
Tmem94	A	G	11: 115,687,641 (GRCm39)	K1167E	probably damaging	Het
Trap1	A	G	16: 3,886,194 (GRCm39)	S88P	probably benign	Het
Ugt2b38	T	C	5: 87,571,591 (GRCm39)	D147G	probably damaging	Het
Vmn1r168	A	T	7: 23,240,824 (GRCm39)	N227I	probably benign	Het
Vmn1r203	T	A	13: 22,709,004 (GRCm39)	S262T	possibly damaging	Het
Vmn1r204	T	G	13: 22,740,420 (GRCm39)	L17R	probably damaging	Het
Zcchc14	T	A	8: 122,330,675 (GRCm39)	Q896L	probably damaging	Het
Zfp619	A	G	7: 39,185,307 (GRCm39)	K446E	possibly damaging	Het

Other mutations in Zpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02960:Zpr1	APN	9	46,184,849 (GRCm39)	missense	probably damaging	0.97
R0077:Zpr1	UTSW	9	46,184,634 (GRCm39)	missense	probably damaging	1.00
R0081:Zpr1	UTSW	9	46,190,995 (GRCm39)	missense	probably damaging	0.99
R0674:Zpr1	UTSW	9	46,186,747 (GRCm39)	missense	probably damaging	1.00
R4956:Zpr1	UTSW	9	46,185,961 (GRCm39)	missense	probably damaging	1.00
R4979:Zpr1	UTSW	9	46,189,640 (GRCm39)	missense	probably benign	0.20
R5566:Zpr1	UTSW	9	46,192,373 (GRCm39)	missense	possibly damaging	0.88
R6480:Zpr1	UTSW	9	46,186,009 (GRCm39)	missense	probably benign	0.01
R6948:Zpr1	UTSW	9	46,184,939 (GRCm39)	critical splice donor site	probably null
R7139:Zpr1	UTSW	9	46,192,357 (GRCm39)	missense	probably damaging	1.00
R7366:Zpr1	UTSW	9	46,184,671 (GRCm39)	splice site	probably null
R7996:Zpr1	UTSW	9	46,184,863 (GRCm39)	missense	possibly damaging	0.95
R8169:Zpr1	UTSW	9	46,189,645 (GRCm39)	missense	possibly damaging	0.91
R8406:Zpr1	UTSW	9	46,185,400 (GRCm39)	missense	probably damaging	1.00
R8829:Zpr1	UTSW	9	46,192,344 (GRCm39)	nonsense	probably null
R9044:Zpr1	UTSW	9	46,190,995 (GRCm39)	missense	probably damaging	0.99
R9408:Zpr1	UTSW	9	46,186,747 (GRCm39)	missense	probably damaging	1.00
R9602:Zpr1	UTSW	9	46,184,663 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCCAATGCATCCTGTCTCG -3'
(R):5'- TTCGAGCTGAAGACATCCCG -3'

Sequencing Primer
(F):5'- TCACAAAGCAGGTGTCAGTC -3'
(R):5'- ATGGTCTTCAAAGGGAGC -3'

Posted On

2014-11-12