Incidental Mutation 'R2420:Hjurp'
ID249177
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
MMRRC Submission 040382-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R2420 (G1)
Quality Score169
Status Not validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GT to GTT at 88266524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
6820408C15Rik A G 2: 152,429,001 K48R probably damaging Het
Acsm2 T C 7: 119,563,634 F44L probably damaging Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Ahnak C T 19: 9,009,256 P2635S possibly damaging Het
Ankrd17 A T 5: 90,289,320 D555E possibly damaging Het
Arhgap29 A G 3: 121,973,980 I24V probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Chst9 A T 18: 15,452,284 N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 K73E possibly damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Egln1 T C 8: 124,948,246 N270S probably benign Het
Eme1 A G 11: 94,645,814 probably null Het
Emilin2 A G 17: 71,274,279 I484T possibly damaging Het
Entpd2 T C 2: 25,399,283 I259T probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Fga A T 3: 83,033,154 N705I possibly damaging Het
Gas1 G T 13: 60,176,930 probably benign Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm44501 A T 17: 40,578,709 H38L possibly damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Jcad T C 18: 4,675,952 M1238T probably damaging Het
Kank1 T C 19: 25,410,457 L498S probably damaging Het
Krt10 G A 11: 99,387,107 T338I possibly damaging Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lilra6 A G 7: 3,914,858 Y96H probably damaging Het
Ltc4s A G 11: 50,237,339 probably null Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mfn1 A G 3: 32,569,515 I263V probably benign Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Mug2 C A 6: 122,083,460 T1385K probably damaging Het
Mypn G T 10: 63,192,869 Y138* probably null Het
Nav3 A C 10: 109,863,813 S273R probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr1290 T C 2: 111,489,257 probably null Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr470 T C 7: 107,844,818 K305R probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pak1 A T 7: 97,854,479 D7V probably benign Het
Pax3 A T 1: 78,196,864 probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Prickle1 A G 15: 93,503,637 F322S probably damaging Het
Prl8a2 A G 13: 27,348,913 E36G possibly damaging Het
Prss45 A G 9: 110,839,092 I118V possibly damaging Het
Psd4 T G 2: 24,401,241 V597G probably damaging Het
Psmb10 A G 8: 105,937,302 S108P probably benign Het
Shank3 A T 15: 89,521,210 K455* probably null Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Tep1 T A 14: 50,834,023 H2055L probably benign Het
Terb1 T C 8: 104,498,595 T14A probably damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyr T A 7: 87,429,189 I488F probably benign Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wnk1 A G 6: 119,936,367 probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp13 A C 17: 23,576,212 Y462D probably damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- ACTGTCATGGTTTGTGATGCCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On2014-11-12