Incidental Mutation 'R0305:Cenpo'
ID24918
Institutional Source Beutler Lab
Gene Symbol Cenpo
Ensembl Gene ENSMUSG00000020652
Gene Namecentromere protein O
Synonyms2810429O05Rik, 8430427C03Rik, D12Ertd482e
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4196004-4234294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4216660 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 149 (H149Q)
Ref Sequence ENSEMBL: ENSMUSP00000119136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020981] [ENSMUST00000020984] [ENSMUST00000111169] [ENSMUST00000124505] [ENSMUST00000127756] [ENSMUST00000128466] [ENSMUST00000140975] [ENSMUST00000152065]
Predicted Effect probably benign
Transcript: ENSMUST00000020981
AA Change: H28Q

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020981
Gene: ENSMUSG00000020652
AA Change: H28Q

DomainStartEndE-ValueType
Pfam:CENP-O 1 74 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020984
SMART Domains Protein: ENSMUSP00000020984
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111169
AA Change: H149Q

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652
AA Change: H149Q

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124505
SMART Domains Protein: ENSMUSP00000122073
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126017
Predicted Effect probably benign
Transcript: ENSMUST00000127756
SMART Domains Protein: ENSMUSP00000115406
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128466
AA Change: H150Q

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121258
Gene: ENSMUSG00000020652
AA Change: H150Q

DomainStartEndE-ValueType
coiled coil region 40 75 N/A INTRINSIC
Pfam:CENP-O 119 196 7.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140975
AA Change: H149Q

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119136
Gene: ENSMUSG00000020652
AA Change: H149Q

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 117 231 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146523
Predicted Effect probably benign
Transcript: ENSMUST00000152065
SMART Domains Protein: ENSMUSP00000115644
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152792
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interphase centromere complex. The encoded protein is localized to the centromere throughout the cell cycle and is required for bipolar spindle assembly, chromosome segregation and checkpoint signaling during mitosis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Cenpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Cenpo APN 12 4216685 missense probably benign 0.02
IGL01661:Cenpo APN 12 4234023 unclassified probably null
IGL02716:Cenpo APN 12 4215390 missense possibly damaging 0.90
R0811:Cenpo UTSW 12 4216643 missense probably benign 0.06
R0812:Cenpo UTSW 12 4216643 missense probably benign 0.06
R1574:Cenpo UTSW 12 4215433 splice site probably null
R1574:Cenpo UTSW 12 4215433 splice site probably null
R1916:Cenpo UTSW 12 4216683 missense probably benign 0.05
R2174:Cenpo UTSW 12 4217318 missense probably benign 0.00
R5384:Cenpo UTSW 12 4216646 missense probably damaging 1.00
R6211:Cenpo UTSW 12 4216733 missense probably benign 0.22
R6238:Cenpo UTSW 12 4231968 missense possibly damaging 0.76
R6630:Cenpo UTSW 12 4217236 unclassified probably benign
R6862:Cenpo UTSW 12 4216539 missense probably damaging 1.00
R7086:Cenpo UTSW 12 4215307 missense probably benign 0.00
R7087:Cenpo UTSW 12 4215307 missense probably benign 0.00
R7088:Cenpo UTSW 12 4215307 missense probably benign 0.00
R7351:Cenpo UTSW 12 4216581 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAAATACCTCAAGTTGGTCTGCCTG -3'
(R):5'- TCGCTTGCTAGACCCTCTGCTAGAAC -3'

Sequencing Primer
(F):5'- AAGTTGGTCTGCCTGGTACTTC -3'
(R):5'- TGTATGCTCAGATGGCAACC -3'
Posted On2013-04-16