Incidental Mutation 'R0305:Cab39l'
ID24924
Institutional Source Beutler Lab
Gene Symbol Cab39l
Ensembl Gene ENSMUSG00000021981
Gene Namecalcium binding protein 39-like
Synonyms4930520C08Rik, MO2L, 1500031K13Rik, 2810425O13Rik
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0305 (G1)
Quality Score210
Status Validated
Chromosome14
Chromosomal Location59440972-59585764 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 59519579 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 137 (Q137*)
Ref Sequence ENSEMBL: ENSMUSP00000153643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022553] [ENSMUST00000225595]
Predicted Effect probably null
Transcript: ENSMUST00000022553
AA Change: Q137*
SMART Domains Protein: ENSMUSP00000022553
Gene: ENSMUSG00000021981
AA Change: Q137*

DomainStartEndE-ValueType
Pfam:Mo25 5 333 1.1e-142 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000225595
AA Change: Q137*
Meta Mutation Damage Score 0.568 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Cab39l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Cab39l APN 14 59496895 missense probably damaging 1.00
IGL03135:Cab39l APN 14 59519651 missense probably benign
R0333:Cab39l UTSW 14 59499611 missense probably damaging 1.00
R0494:Cab39l UTSW 14 59499559 missense probably damaging 0.99
R1524:Cab39l UTSW 14 59519737 splice site probably benign
R4061:Cab39l UTSW 14 59499607 missense possibly damaging 0.64
R4066:Cab39l UTSW 14 59547005 missense probably benign 0.00
R4542:Cab39l UTSW 14 59496902 missense probably benign 0.00
R4681:Cab39l UTSW 14 59499605 missense probably benign 0.00
R5217:Cab39l UTSW 14 59526809 nonsense probably null
R6196:Cab39l UTSW 14 59499590 missense probably damaging 1.00
R6427:Cab39l UTSW 14 59506270 missense possibly damaging 0.79
R7234:Cab39l UTSW 14 59496946 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCACACTAAATTGCTCAGTTTTCTGC -3'
(R):5'- AGAGGGGCTTATCACCTTACTCTGC -3'

Sequencing Primer
(F):5'- gcagtgacagtgaccttcc -3'
(R):5'- AGTCATTCCACTGAGCTGAG -3'
Posted On2013-04-16