Incidental Mutation 'R2422:Wdr77'
ID249356
Institutional Source Beutler Lab
Gene Symbol Wdr77
Ensembl Gene ENSMUSG00000000561
Gene NameWD repeat domain 77
Synonyms2610003I18Rik, 2610312E17Rik, p44/MEP50
MMRRC Submission 040384-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2422 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105959369-105970037 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105960021 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 62 (K62*)
Ref Sequence ENSEMBL: ENSMUSP00000010278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010278] [ENSMUST00000118209] [ENSMUST00000128005] [ENSMUST00000130994] [ENSMUST00000133320]
Predicted Effect probably null
Transcript: ENSMUST00000010278
AA Change: K62*
SMART Domains Protein: ENSMUSP00000010278
Gene: ENSMUSG00000000561
AA Change: K62*

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
WD40 70 107 5.11e1 SMART
WD40 115 153 1.06e-3 SMART
WD40 156 196 4.51e-7 SMART
WD40 201 241 2.75e1 SMART
WD40 244 284 9.94e-1 SMART
WD40 286 326 1.99e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118209
SMART Domains Protein: ENSMUSP00000113022
Gene: ENSMUSG00000000563

DomainStartEndE-ValueType
Pfam:Mt_ATP-synt_B 83 244 2.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127464
Predicted Effect probably benign
Transcript: ENSMUST00000128005
SMART Domains Protein: ENSMUSP00000122465
Gene: ENSMUSG00000000561

DomainStartEndE-ValueType
WD40 13 51 1.06e-3 SMART
WD40 54 94 4.51e-7 SMART
WD40 99 139 2.75e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130994
AA Change: Q58L
SMART Domains Protein: ENSMUSP00000120517
Gene: ENSMUSG00000000561
AA Change: Q58L

DomainStartEndE-ValueType
PDB:4GQB|B 1 52 8e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an androgen receptor coactivator that forms a complex with protein arginine methyltransferase 5, which modifies specific arginines to dimethylarginines in several spliceosomal Sm proteins. The encoded protein may be involved in the early stages of prostate cancer, with most of the protein being nuclear-localized in benign cells but cytoplasmic in cancer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to E8.5 for unknown reasons. Heterozygotes develop multifocal hyperplasia in the dorsal prostate; however, no prostate tumors are detected up to 12 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
4933409G03Rik A T 2: 68,591,520 N47I probably benign Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adck2 C T 6: 39,583,998 A440V possibly damaging Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Ccdc77 A G 6: 120,339,159 C186R probably benign Het
Cdk12 T G 11: 98,219,074 S640R probably benign Het
Cdv3 T C 9: 103,365,118 probably benign Het
Celf2 G A 2: 6,553,889 T364I probably damaging Het
Cmtr2 C A 8: 110,222,781 S574R probably benign Het
Col14a1 T C 15: 55,449,922 L56P unknown Het
Dctn1 C T 6: 83,199,800 L1241F possibly damaging Het
Depdc5 T C 5: 32,991,035 F1505S probably damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Entpd7 A T 19: 43,728,088 Y507F possibly damaging Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Galr1 A T 18: 82,405,923 N76K probably damaging Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm4950 T A 18: 51,865,784 Q33L probably benign Het
Gm5415 C T 1: 32,545,861 A323T possibly damaging Het
Gm6583 A T 5: 112,355,118 V240D probably damaging Het
Gnat2 A T 3: 108,095,539 M88L probably damaging Het
Gpr183 A G 14: 121,954,177 Y311H probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hipk3 C T 2: 104,471,485 G121R probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Homez C A 14: 54,857,574 V226F probably benign Het
Inf2 C A 12: 112,610,824 A1034D unknown Het
Kcnc4 G T 3: 107,445,547 P572T probably benign Het
Kmt2d T C 15: 98,862,266 E1037G unknown Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lmbrd2 C T 15: 9,194,765 T618M possibly damaging Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mib1 T C 18: 10,751,906 S263P probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Nek1 T C 8: 61,019,901 V152A probably damaging Het
Nlrp4d T A 7: 10,362,945 D876V probably benign Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr235 A T 19: 12,268,919 T230S probably damaging Het
Olfr740 T C 14: 50,453,436 L128P probably damaging Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pcdha11 G T 18: 37,007,272 L651F probably damaging Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Plxnb1 G A 9: 109,108,438 R1169H probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Pum2 A T 12: 8,748,931 Q930L possibly damaging Het
Rbp4 T C 19: 38,124,344 E67G probably damaging Het
Rgs9 C A 11: 109,225,777 probably null Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Smc1a A G X: 152,047,975 probably benign Het
Snx33 C A 9: 56,918,538 M546I probably benign Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Spata2 C T 2: 167,484,206 R231Q probably damaging Het
Stard9 C T 2: 120,700,284 R2341C probably benign Het
Tas2r116 A T 6: 132,855,594 I53F possibly damaging Het
Tlk1 T C 2: 70,770,005 E110G probably damaging Het
Tmem102 T A 11: 69,804,537 E203V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp266 C A 9: 20,499,262 V540L possibly damaging Het
Zfp638 C A 6: 83,966,439 probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp951 G A 5: 104,815,277 T141I probably benign Het
Other mutations in Wdr77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Wdr77 APN 3 105959686 nonsense probably null
R0368:Wdr77 UTSW 3 105962066 critical splice donor site probably null
R0436:Wdr77 UTSW 3 105960026 missense probably damaging 1.00
R1403:Wdr77 UTSW 3 105967257 missense possibly damaging 0.76
R1403:Wdr77 UTSW 3 105967257 missense possibly damaging 0.76
R1928:Wdr77 UTSW 3 105967302 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAGATTCAGACTGGTCCC -3'
(R):5'- GTGACAGAGCAGTTGCCTAG -3'

Sequencing Primer
(F):5'- ATTCAGACTGGTCCCGCCAC -3'
(R):5'- AAGACTTCTGTGAGTTCAAGGCC -3'
Posted On2014-11-12