Incidental Mutation 'R2422:Gnat2'
ID249358
Institutional Source Beutler Lab
Gene Symbol Gnat2
Ensembl Gene ENSMUSG00000009108
Gene Nameguanine nucleotide binding protein, alpha transducing 2
SynonymsGt-2, Tcalpha, Gnat-2
MMRRC Submission 040384-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R2422 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108092789-108101432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108095539 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 88 (M88L)
Ref Sequence ENSEMBL: ENSMUSP00000123125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058669] [ENSMUST00000131856] [ENSMUST00000145101] [ENSMUST00000151326]
Predicted Effect probably benign
Transcript: ENSMUST00000058669
AA Change: M88L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000053818
Gene: ENSMUSG00000009108
AA Change: M88L

DomainStartEndE-ValueType
G_alpha 13 353 1.53e-221 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130013
Predicted Effect probably benign
Transcript: ENSMUST00000131856
AA Change: M36L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121533
Gene: ENSMUSG00000009108
AA Change: M36L

DomainStartEndE-ValueType
G_alpha 1 249 5.5e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142568
Predicted Effect probably damaging
Transcript: ENSMUST00000145101
AA Change: M88L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123125
Gene: ENSMUSG00000009108
AA Change: M88L

DomainStartEndE-ValueType
Pfam:G-alpha 4 113 1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151326
AA Change: M88L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120425
Gene: ENSMUSG00000009108
AA Change: M88L

DomainStartEndE-ValueType
G_alpha 13 232 1.48e-73 SMART
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in progressive degeneration of photoreceptors and normal ERG responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
4933409G03Rik A T 2: 68,591,520 N47I probably benign Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adck2 C T 6: 39,583,998 A440V possibly damaging Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Ccdc77 A G 6: 120,339,159 C186R probably benign Het
Cdk12 T G 11: 98,219,074 S640R probably benign Het
Cdv3 T C 9: 103,365,118 probably benign Het
Celf2 G A 2: 6,553,889 T364I probably damaging Het
Cmtr2 C A 8: 110,222,781 S574R probably benign Het
Col14a1 T C 15: 55,449,922 L56P unknown Het
Dctn1 C T 6: 83,199,800 L1241F possibly damaging Het
Depdc5 T C 5: 32,991,035 F1505S probably damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Entpd7 A T 19: 43,728,088 Y507F possibly damaging Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Galr1 A T 18: 82,405,923 N76K probably damaging Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm4950 T A 18: 51,865,784 Q33L probably benign Het
Gm5415 C T 1: 32,545,861 A323T possibly damaging Het
Gm6583 A T 5: 112,355,118 V240D probably damaging Het
Gpr183 A G 14: 121,954,177 Y311H probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hipk3 C T 2: 104,471,485 G121R probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Homez C A 14: 54,857,574 V226F probably benign Het
Inf2 C A 12: 112,610,824 A1034D unknown Het
Kcnc4 G T 3: 107,445,547 P572T probably benign Het
Kmt2d T C 15: 98,862,266 E1037G unknown Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lmbrd2 C T 15: 9,194,765 T618M possibly damaging Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mib1 T C 18: 10,751,906 S263P probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Nek1 T C 8: 61,019,901 V152A probably damaging Het
Nlrp4d T A 7: 10,362,945 D876V probably benign Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr235 A T 19: 12,268,919 T230S probably damaging Het
Olfr740 T C 14: 50,453,436 L128P probably damaging Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pcdha11 G T 18: 37,007,272 L651F probably damaging Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Plxnb1 G A 9: 109,108,438 R1169H probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Pum2 A T 12: 8,748,931 Q930L possibly damaging Het
Rbp4 T C 19: 38,124,344 E67G probably damaging Het
Rgs9 C A 11: 109,225,777 probably null Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Smc1a A G X: 152,047,975 probably benign Het
Snx33 C A 9: 56,918,538 M546I probably benign Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Spata2 C T 2: 167,484,206 R231Q probably damaging Het
Stard9 C T 2: 120,700,284 R2341C probably benign Het
Tas2r116 A T 6: 132,855,594 I53F possibly damaging Het
Tlk1 T C 2: 70,770,005 E110G probably damaging Het
Tmem102 T A 11: 69,804,537 E203V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wdr77 A T 3: 105,960,021 K62* probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp266 C A 9: 20,499,262 V540L possibly damaging Het
Zfp638 C A 6: 83,966,439 probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp951 G A 5: 104,815,277 T141I probably benign Het
Other mutations in Gnat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03011:Gnat2 APN 3 108100052 missense probably damaging 1.00
R0281:Gnat2 UTSW 3 108095562 nonsense probably null
R4832:Gnat2 UTSW 3 108100648 missense probably benign 0.00
R4844:Gnat2 UTSW 3 108095515 missense probably damaging 1.00
R4940:Gnat2 UTSW 3 108100616 missense probably benign
R5430:Gnat2 UTSW 3 108098400 missense probably damaging 1.00
R6109:Gnat2 UTSW 3 108100135 missense probably damaging 1.00
R6870:Gnat2 UTSW 3 108095631 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAGGACCTACTCTCCAATGTCC -3'
(R):5'- TTGGAAGTTCAGCAGATGCC -3'

Sequencing Primer
(F):5'- GGAATACAGGTAGTTTCCTCTGACC -3'
(R):5'- AGTTCAGCAGATGCCATTTGAG -3'
Posted On2014-11-12