Incidental Mutation 'R2422:Zfp638'
ID249371
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Namezinc finger protein 638
SynonymsNp220, Zfml
MMRRC Submission 040384-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R2422 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83867109-83989550 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 83966439 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000203891] [ENSMUST00000204751]
Predicted Effect probably benign
Transcript: ENSMUST00000032088
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113835
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113836
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203324
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203455
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203481
Predicted Effect probably benign
Transcript: ENSMUST00000203891
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204120
Predicted Effect probably benign
Transcript: ENSMUST00000204751
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204953
Predicted Effect probably benign
Transcript: ENSMUST00000205166
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
4933409G03Rik A T 2: 68,591,520 N47I probably benign Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adck2 C T 6: 39,583,998 A440V possibly damaging Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Ccdc77 A G 6: 120,339,159 C186R probably benign Het
Cdk12 T G 11: 98,219,074 S640R probably benign Het
Cdv3 T C 9: 103,365,118 probably benign Het
Celf2 G A 2: 6,553,889 T364I probably damaging Het
Cmtr2 C A 8: 110,222,781 S574R probably benign Het
Col14a1 T C 15: 55,449,922 L56P unknown Het
Dctn1 C T 6: 83,199,800 L1241F possibly damaging Het
Depdc5 T C 5: 32,991,035 F1505S probably damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Entpd7 A T 19: 43,728,088 Y507F possibly damaging Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Galr1 A T 18: 82,405,923 N76K probably damaging Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm4950 T A 18: 51,865,784 Q33L probably benign Het
Gm5415 C T 1: 32,545,861 A323T possibly damaging Het
Gm6583 A T 5: 112,355,118 V240D probably damaging Het
Gnat2 A T 3: 108,095,539 M88L probably damaging Het
Gpr183 A G 14: 121,954,177 Y311H probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hipk3 C T 2: 104,471,485 G121R probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Homez C A 14: 54,857,574 V226F probably benign Het
Inf2 C A 12: 112,610,824 A1034D unknown Het
Kcnc4 G T 3: 107,445,547 P572T probably benign Het
Kmt2d T C 15: 98,862,266 E1037G unknown Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lmbrd2 C T 15: 9,194,765 T618M possibly damaging Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mib1 T C 18: 10,751,906 S263P probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Nek1 T C 8: 61,019,901 V152A probably damaging Het
Nlrp4d T A 7: 10,362,945 D876V probably benign Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr235 A T 19: 12,268,919 T230S probably damaging Het
Olfr740 T C 14: 50,453,436 L128P probably damaging Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pcdha11 G T 18: 37,007,272 L651F probably damaging Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Plxnb1 G A 9: 109,108,438 R1169H probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Pum2 A T 12: 8,748,931 Q930L possibly damaging Het
Rbp4 T C 19: 38,124,344 E67G probably damaging Het
Rgs9 C A 11: 109,225,777 probably null Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Smc1a A G X: 152,047,975 probably benign Het
Snx33 C A 9: 56,918,538 M546I probably benign Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Spata2 C T 2: 167,484,206 R231Q probably damaging Het
Stard9 C T 2: 120,700,284 R2341C probably benign Het
Tas2r116 A T 6: 132,855,594 I53F possibly damaging Het
Tlk1 T C 2: 70,770,005 E110G probably damaging Het
Tmem102 T A 11: 69,804,537 E203V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wdr77 A T 3: 105,960,021 K62* probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp266 C A 9: 20,499,262 V540L possibly damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp951 G A 5: 104,815,277 T141I probably benign Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83979718 missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83956698 missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83977130 missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83929164 missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83934994 missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83944798 missense probably benign 0.01
IGL01570:Zfp638 APN 6 83947847 missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83979526 missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83984875 missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83969232 missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83984884 missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83935018 splice site probably benign
IGL03135:Zfp638 APN 6 83942875 missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83946247 missense probably benign 0.04
R0190:Zfp638 UTSW 6 83928964 missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83967354 missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83972238 unclassified probably benign
R0938:Zfp638 UTSW 6 83984041 missense probably benign 0.16
R1312:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83944656 missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83978065 intron probably null
R1634:Zfp638 UTSW 6 83979912 splice site probably null
R1651:Zfp638 UTSW 6 83954737 missense probably benign 0.00
R2079:Zfp638 UTSW 6 83953389 critical splice donor site probably null
R2134:Zfp638 UTSW 6 83928982 missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83986596 missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83929518 missense probably damaging 1.00
R4353:Zfp638 UTSW 6 83984059 missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83981737 missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83979562 nonsense probably null
R4807:Zfp638 UTSW 6 83943058 missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83979475 missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83929456 missense probably benign 0.03
R5236:Zfp638 UTSW 6 83976575 nonsense probably null
R5323:Zfp638 UTSW 6 83962094 missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83976414 missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83967363 missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83979188 missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83929641 missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83943129 missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83929987 missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83929072 missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83944847 missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83977065 missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83867230 missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83965578 missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83930110 missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83953126 missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83954726 missense probably benign 0.00
R7141:Zfp638 UTSW 6 83867199 missense unknown
Z1088:Zfp638 UTSW 6 83944811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGTCATCCTAACTTGTTAGC -3'
(R):5'- AAGGACTATGATACCCTTTCCG -3'

Sequencing Primer
(F):5'- TCCTAACTTGTTAGCAATAGTAGGG -3'
(R):5'- CCAAGAACCATCTAATATCTCAG -3'
Posted On2014-11-12