Incidental Mutation 'R0305:Nrxn2'
ID24943
Institutional Source Beutler Lab
Gene Symbol Nrxn2
Ensembl Gene ENSMUSG00000033768
Gene Nameneurexin II
Synonyms6430591O13Rik, neurexin II beta, neurexin II alpha
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6418731-6544169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6519283 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1403 (C1403Y)
Ref Sequence ENSEMBL: ENSMUSP00000119762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113458] [ENSMUST00000113459] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166]
Predicted Effect probably damaging
Transcript: ENSMUST00000077182
AA Change: C1388Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768
AA Change: C1388Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 444 1.18e-33 SMART
LamG 498 651 1.51e-40 SMART
EGF 678 712 8.91e-3 SMART
LamG 737 875 4.91e-22 SMART
LamG 923 1059 1.08e-41 SMART
EGF 1084 1118 1.91e1 SMART
LamG 1146 1303 4.48e-16 SMART
low complexity region 1332 1362 N/A INTRINSIC
low complexity region 1430 1445 N/A INTRINSIC
4.1m 1448 1466 3.75e-4 SMART
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113458
AA Change: C353Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109085
Gene: ENSMUSG00000033768
AA Change: C353Y

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 268 4.48e-16 SMART
low complexity region 297 327 N/A INTRINSIC
low complexity region 383 404 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
4.1m 605 623 3.75e-4 SMART
low complexity region 637 656 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113459
AA Change: C323Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768
AA Change: C323Y

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 238 1.26e-19 SMART
low complexity region 267 297 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113461
AA Change: C1333Y

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: C1333Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
LamG 286 428 8.4e-30 SMART
LamG 482 635 1.51e-40 SMART
EGF 662 696 8.91e-3 SMART
LamG 721 850 2.36e-24 SMART
LamG 898 1034 1.08e-41 SMART
EGF 1059 1093 1.91e1 SMART
LamG 1121 1248 1.26e-19 SMART
low complexity region 1277 1307 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
low complexity region 1567 1582 N/A INTRINSIC
4.1m 1585 1603 3.75e-4 SMART
low complexity region 1617 1636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113462
AA Change: C1396Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: C1396Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 452 8.4e-30 SMART
LamG 506 659 1.51e-40 SMART
EGF 686 720 8.91e-3 SMART
LamG 745 883 4.91e-22 SMART
LamG 931 1067 1.08e-41 SMART
EGF 1092 1126 1.91e1 SMART
LamG 1154 1311 4.48e-16 SMART
low complexity region 1340 1370 N/A INTRINSIC
low complexity region 1426 1447 N/A INTRINSIC
low complexity region 1630 1645 N/A INTRINSIC
4.1m 1648 1666 3.75e-4 SMART
low complexity region 1680 1699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137166
AA Change: C1403Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: C1403Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 459 8.87e-29 SMART
LamG 513 666 1.51e-40 SMART
EGF 693 727 8.91e-3 SMART
LamG 752 890 4.91e-22 SMART
LamG 938 1074 1.08e-41 SMART
EGF 1099 1133 1.91e1 SMART
LamG 1161 1318 4.48e-16 SMART
low complexity region 1347 1377 N/A INTRINSIC
low complexity region 1433 1454 N/A INTRINSIC
low complexity region 1637 1652 N/A INTRINSIC
4.1m 1655 1673 3.75e-4 SMART
low complexity region 1687 1706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154580
Meta Mutation Damage Score 0.516 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Nrxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nrxn2 APN 19 6473593 missense possibly damaging 0.84
IGL01020:Nrxn2 APN 19 6493443 missense probably benign 0.02
IGL01064:Nrxn2 APN 19 6517053 missense probably damaging 0.97
IGL01561:Nrxn2 APN 19 6490142 missense probably damaging 1.00
IGL01759:Nrxn2 APN 19 6509929 missense probably damaging 1.00
IGL02071:Nrxn2 APN 19 6481753 missense probably damaging 1.00
IGL02085:Nrxn2 APN 19 6492868 missense possibly damaging 0.83
IGL02132:Nrxn2 APN 19 6472276 missense probably damaging 1.00
IGL02476:Nrxn2 APN 19 6454985 missense probably damaging 1.00
IGL02605:Nrxn2 APN 19 6450580 missense probably benign 0.02
IGL03123:Nrxn2 APN 19 6481737 missense probably damaging 0.98
IGL03288:Nrxn2 APN 19 6490696 missense probably damaging 1.00
PIT4687001:Nrxn2 UTSW 19 6481308 missense probably benign 0.06
R0019:Nrxn2 UTSW 19 6509957 splice site probably benign
R0257:Nrxn2 UTSW 19 6490698 missense possibly damaging 0.81
R0453:Nrxn2 UTSW 19 6491521 missense probably damaging 1.00
R0512:Nrxn2 UTSW 19 6517198 missense probably damaging 1.00
R0539:Nrxn2 UTSW 19 6493404 missense probably damaging 0.99
R0571:Nrxn2 UTSW 19 6473533 missense probably damaging 1.00
R1373:Nrxn2 UTSW 19 6472301 missense probably damaging 1.00
R1434:Nrxn2 UTSW 19 6443612 intron probably null
R1454:Nrxn2 UTSW 19 6481446 missense probably damaging 0.98
R1671:Nrxn2 UTSW 19 6473750 missense probably damaging 1.00
R1692:Nrxn2 UTSW 19 6519268 missense probably damaging 1.00
R1858:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R1859:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R2153:Nrxn2 UTSW 19 6504914 missense probably damaging 1.00
R2196:Nrxn2 UTSW 19 6490109 missense probably damaging 1.00
R2209:Nrxn2 UTSW 19 6493007 missense probably benign 0.01
R2278:Nrxn2 UTSW 19 6481853 missense probably damaging 1.00
R2441:Nrxn2 UTSW 19 6428301 missense probably damaging 1.00
R3897:Nrxn2 UTSW 19 6519257 missense probably damaging 1.00
R3943:Nrxn2 UTSW 19 6473335 missense probably damaging 1.00
R4091:Nrxn2 UTSW 19 6473414 missense probably damaging 1.00
R4162:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4164:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4495:Nrxn2 UTSW 19 6531399 missense probably benign 0.05
R4599:Nrxn2 UTSW 19 6455252 missense probably damaging 0.98
R4735:Nrxn2 UTSW 19 6498454 missense possibly damaging 0.86
R4757:Nrxn2 UTSW 19 6509821 missense probably damaging 1.00
R4890:Nrxn2 UTSW 19 6448278 missense possibly damaging 0.90
R5052:Nrxn2 UTSW 19 6455204 missense probably damaging 1.00
R5311:Nrxn2 UTSW 19 6531398 missense probably benign 0.05
R5330:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5331:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5530:Nrxn2 UTSW 19 6498367 missense possibly damaging 0.93
R5556:Nrxn2 UTSW 19 6490091 missense probably damaging 1.00
R5763:Nrxn2 UTSW 19 6531339 missense probably benign 0.15
R5829:Nrxn2 UTSW 19 6490849 missense probably benign 0.03
R5988:Nrxn2 UTSW 19 6492871 missense possibly damaging 0.83
R6003:Nrxn2 UTSW 19 6498328 missense possibly damaging 0.93
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6288:Nrxn2 UTSW 19 6490561 missense probably damaging 1.00
R6334:Nrxn2 UTSW 19 6531292 unclassified probably null
R6373:Nrxn2 UTSW 19 6509830 missense probably damaging 1.00
R6397:Nrxn2 UTSW 19 6532122 missense probably damaging 1.00
R6669:Nrxn2 UTSW 19 6481191 missense probably damaging 1.00
R6980:Nrxn2 UTSW 19 6450579 missense probably benign 0.04
R6985:Nrxn2 UTSW 19 6481245 missense probably damaging 1.00
R7184:Nrxn2 UTSW 19 6490552 missense probably damaging 1.00
R7361:Nrxn2 UTSW 19 6517082 missense probably benign 0.00
X0022:Nrxn2 UTSW 19 6509917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTGTCTGATCTTTGGGAGCC -3'
(R):5'- TGCCAACAGAGACCTCTATGAGTGG -3'

Sequencing Primer
(F):5'- CTGATCTTTGGGAGCCACAGG -3'
(R):5'- TTCACTATCTCCAAGGATGGGAC -3'
Posted On2013-04-16