Incidental Mutation 'R2423:Amer2'
ID249453
Institutional Source Beutler Lab
Gene Symbol Amer2
Ensembl Gene ENSMUSG00000021986
Gene NameAPC membrane recruitment 2
SynonymsFam123a, 2600011E07Rik, Amer2
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R2423 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location60373259-60388197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60379207 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 284 (S284P)
Ref Sequence ENSEMBL: ENSMUSP00000022561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022561] [ENSMUST00000224957] [ENSMUST00000225247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022561
AA Change: S284P

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022561
Gene: ENSMUSG00000021986
AA Change: S284P

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:WTX 57 554 5.2e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224957
Predicted Effect probably benign
Transcript: ENSMUST00000225247
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Amer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Amer2 APN 14 60379907 missense possibly damaging 0.82
IGL03306:Amer2 APN 14 60378552 missense probably damaging 1.00
IGL03382:Amer2 APN 14 60379882 missense possibly damaging 0.77
R0365:Amer2 UTSW 14 60379535 missense probably damaging 0.99
R0433:Amer2 UTSW 14 60378583 missense probably damaging 0.99
R1696:Amer2 UTSW 14 60379674 missense possibly damaging 0.65
R1754:Amer2 UTSW 14 60379757 missense probably damaging 1.00
R1991:Amer2 UTSW 14 60379820 missense probably damaging 0.96
R2018:Amer2 UTSW 14 60378445 missense probably damaging 1.00
R3160:Amer2 UTSW 14 60378551 missense probably damaging 1.00
R3161:Amer2 UTSW 14 60378551 missense probably damaging 1.00
R3162:Amer2 UTSW 14 60378551 missense probably damaging 1.00
R4928:Amer2 UTSW 14 60379445 missense possibly damaging 0.92
R4981:Amer2 UTSW 14 60379727 missense probably damaging 1.00
R5212:Amer2 UTSW 14 60379820 missense probably damaging 0.96
R5535:Amer2 UTSW 14 60378853 small deletion probably benign
R5685:Amer2 UTSW 14 60379577 nonsense probably null
R6002:Amer2 UTSW 14 60378782 missense possibly damaging 0.93
R6247:Amer2 UTSW 14 60378872 missense probably damaging 0.96
R6408:Amer2 UTSW 14 60380225 missense probably damaging 0.96
R7271:Amer2 UTSW 14 60379674 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AAGGGATCTTCAGCAGCATG -3'
(R):5'- GTCAAAGCTTTTCAGTGAAGTCAC -3'

Sequencing Primer
(F):5'- AGCCTGGAGTGCGTCAAG -3'
(R):5'- GTGAAGTCACGTCAGAAAACATC -3'
Posted On2014-11-12