Incidental Mutation 'R2424:Acot3'
ID249504
Institutional Source Beutler Lab
Gene Symbol Acot3
Ensembl Gene ENSMUSG00000021228
Gene Nameacyl-CoA thioesterase 3
SynonymsPte2a, PTE-Ia
MMRRC Submission 040386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2424 (G1)
Quality Score187
Status Validated
Chromosome12
Chromosomal Location84052144-84060402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84053864 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 138 (R138L)
Ref Sequence ENSEMBL: ENSMUSP00000152164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021653] [ENSMUST00000120927] [ENSMUST00000223080]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021653
AA Change: R138L

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021653
Gene: ENSMUSG00000021228
AA Change: R138L

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 27 152 7.3e-47 PFAM
low complexity region 158 172 N/A INTRINSIC
Pfam:BAAT_C 214 423 3.7e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120927
AA Change: R127L

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112678
Gene: ENSMUSG00000021228
AA Change: R127L

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 142 1.9e-39 PFAM
low complexity region 147 161 N/A INTRINSIC
Pfam:BAAT_C 203 412 1.7e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180751
Predicted Effect probably benign
Transcript: ENSMUST00000221229
Predicted Effect probably damaging
Transcript: ENSMUST00000223080
AA Change: R138L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,756 T691A probably benign Het
Aacs A G 5: 125,513,095 probably null Het
Ago3 A G 4: 126,404,247 V160A probably damaging Het
Akap9 A C 5: 4,065,279 E166D probably damaging Het
Arid5a T C 1: 36,318,501 Y136H probably damaging Het
Ascc3 T C 10: 50,618,201 V244A probably benign Het
Atp10a A T 7: 58,794,555 H560L probably benign Het
Btbd6 A G 12: 112,978,360 T482A probably benign Het
Cacna1d A T 14: 30,049,023 Y1828N probably damaging Het
Capzb A G 4: 139,194,130 M1V probably null Het
Cdh9 T G 15: 16,850,354 F524L probably damaging Het
Ctnna1 T C 18: 35,253,707 S846P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 T A 4: 98,945,307 R1886* probably null Het
Dpp3 A T 19: 4,907,707 L711* probably null Het
Dst T A 1: 34,167,060 I566N probably damaging Het
Eif2b3 T A 4: 117,070,848 S421R probably benign Het
Epg5 T C 18: 77,968,613 V825A probably benign Het
Eya1 T A 1: 14,270,848 probably benign Het
Fam187a T C 11: 102,885,954 Y195H probably damaging Het
Fbn2 C T 18: 58,203,787 C132Y probably damaging Het
Fbxw21 A T 9: 109,157,519 Y97* probably null Het
Grin1 A T 2: 25,318,652 C79S probably null Het
Haao T A 17: 83,835,562 Y118F probably damaging Het
Il11ra1 T A 4: 41,768,222 S378T probably damaging Het
Kcnj5 A T 9: 32,322,820 N66K probably damaging Het
Kif21a T A 15: 90,971,196 N668I probably damaging Het
Kprp A T 3: 92,825,605 L46Q probably damaging Het
Lama1 C T 17: 67,798,665 T2056I probably benign Het
Madd G C 2: 91,166,622 D824E probably damaging Het
Mapk9 A G 11: 49,863,672 N84S probably damaging Het
Mrpl39 A G 16: 84,730,860 V160A probably benign Het
Mrpl9 T C 3: 94,443,806 S98P probably benign Het
Mybpc3 A T 2: 91,135,793 M1233L probably benign Het
Neb A G 2: 52,209,659 probably benign Het
Ngly1 A G 14: 16,290,721 probably null Het
Nt5c1b A T 12: 10,370,072 T4S probably damaging Het
Obscn T C 11: 58,994,451 probably benign Het
Olfr725 T C 14: 50,034,824 Y193C probably damaging Het
Olfr904 T C 9: 38,464,832 S264P probably damaging Het
Olfr92 T C 17: 37,111,516 I155M probably benign Het
Olfr968 A G 9: 39,772,297 F168L probably benign Het
Otog A T 7: 46,298,169 K64* probably null Het
Papola A G 12: 105,827,052 T544A probably benign Het
Phc1 A G 6: 122,320,043 V790A probably damaging Het
Phf3 G T 1: 30,806,349 R1252S probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs17 T A 10: 5,833,111 I159F probably damaging Het
Rgs17 T A 10: 5,842,560 E62V probably benign Het
Rnase1 A G 14: 51,145,547 Y117H possibly damaging Het
Rnf214 T C 9: 45,899,798 D189G probably damaging Het
Sema4b A G 7: 80,219,275 N365S probably damaging Het
Setd2 A G 9: 110,617,522 H2480R probably benign Het
Slc27a6 G T 18: 58,605,117 C415F probably benign Het
Stim1 A G 7: 102,408,405 I142V probably benign Het
Supt5 T C 7: 28,315,165 I1070V possibly damaging Het
Tbp T C 17: 15,513,533 F174L possibly damaging Het
Tex26 A G 5: 149,470,448 probably benign Het
Tmem132d A G 5: 127,864,599 V479A probably benign Het
Ttn T C 2: 76,881,145 probably benign Het
Urb2 T A 8: 124,030,426 N957K probably benign Het
Usp24 T C 4: 106,399,113 probably null Het
Vmn2r114 T C 17: 23,296,868 T550A possibly damaging Het
Vmn2r72 A G 7: 85,750,953 V296A probably damaging Het
Vmn2r91 C A 17: 18,136,169 Y699* probably null Het
Other mutations in Acot3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Acot3 APN 12 84057089 missense probably benign 0.11
IGL02299:Acot3 APN 12 84058811 nonsense probably null
IGL03407:Acot3 APN 12 84058641 missense probably damaging 0.99
R0557:Acot3 UTSW 12 84058856 missense probably damaging 1.00
R1388:Acot3 UTSW 12 84058987 missense possibly damaging 0.82
R1600:Acot3 UTSW 12 84058710 missense probably benign 0.00
R1711:Acot3 UTSW 12 84053573 missense probably damaging 1.00
R1718:Acot3 UTSW 12 84053943 critical splice donor site probably null
R1939:Acot3 UTSW 12 84058551 missense probably benign
R2073:Acot3 UTSW 12 84053456 missense possibly damaging 0.53
R4688:Acot3 UTSW 12 84053917 missense probably damaging 0.97
R4739:Acot3 UTSW 12 84058590 missense probably benign 0.00
R5633:Acot3 UTSW 12 84058950 unclassified probably null
R6008:Acot3 UTSW 12 84057086 missense probably damaging 1.00
R6746:Acot3 UTSW 12 84053474 missense probably benign
R7017:Acot3 UTSW 12 84053303 start gained probably benign
X0066:Acot3 UTSW 12 84057038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGCCTTTGTGACCAGC -3'
(R):5'- CTTAAGGCTTTTCCAGGGAGCC -3'

Sequencing Primer
(F):5'- TGTCCTGCGCGACGAGAAG -3'
(R):5'- AGCCCCCTGAAAAGTGTG -3'
Posted On2014-11-12