Mutagenetix > Incidental Mutation

Incidental Mutation 'R2435:Itgae'

249555

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

alpha-E1, CD103

MMRRC Submission

040396-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2435 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72981409-73038272 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 73012763 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 698 (C698*)

Ref Sequence

ENSEMBL: ENSMUSP00000099596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

probably null
Transcript: ENSMUST00000006101
AA Change: C698*

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: C698*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102537
AA Change: C698*

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: C698*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	T	19: 31,898,294 (GRCm39)	T226I	probably benign	Het
Acvr1	T	C	2: 58,369,704 (GRCm39)	N102D	probably damaging	Het
Cd34	T	A	1: 194,621,334 (GRCm39)	C21S	probably damaging	Het
Cdh18	C	T	15: 23,367,094 (GRCm39)	R267W	probably damaging	Het
Ckap5	T	A	2: 91,411,490 (GRCm39)	N966K	probably benign	Het
Clec4e	A	G	6: 123,265,855 (GRCm39)	V44A	probably damaging	Het
Cubn	T	A	2: 13,323,083 (GRCm39)	N2828I	probably damaging	Het
Dnah10	G	T	5: 124,839,929 (GRCm39)		probably null	Het
Fshr	A	T	17: 89,508,024 (GRCm39)	V6D	unknown	Het
Gcc2	A	G	10: 58,130,602 (GRCm39)	D1398G	probably damaging	Het
Gpi1	G	A	7: 33,905,254 (GRCm39)	A390V	probably damaging	Het
Gypa	G	T	8: 81,233,397 (GRCm39)		probably null	Het
Hsp90aa1	T	A	12: 110,662,114 (GRCm39)	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,662,115 (GRCm39)		probably null	Het
Ifna13	T	A	4: 88,562,366 (GRCm39)	Q86L	probably damaging	Het
Ivns1abp	T	C	1: 151,239,061 (GRCm39)	V625A	probably benign	Het
Kcnh2	A	G	5: 24,531,345 (GRCm39)		probably null	Het
Kcnj6	G	A	16: 94,563,538 (GRCm39)	T320M	probably damaging	Het
Mblac2	T	C	13: 81,898,368 (GRCm39)	I248T	probably damaging	Het
Muc5ac	A	T	7: 141,371,841 (GRCm39)	Y2647F	possibly damaging	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Or4k15	T	C	14: 50,364,211 (GRCm39)	M59T	probably damaging	Het
Or6c217	G	T	10: 129,738,173 (GRCm39)	N135K	possibly damaging	Het
Pard3b	T	A	1: 62,626,897 (GRCm39)	V1059E	probably damaging	Het
Pkd1l3	A	C	8: 110,377,334 (GRCm39)	I1585L	probably benign	Het
Pramel31	A	T	4: 144,089,473 (GRCm39)	I264F	possibly damaging	Het
Prrc2b	A	T	2: 32,109,741 (GRCm39)	S1791C	probably damaging	Het
Rbmxl2	C	A	7: 106,809,538 (GRCm39)	S274R	probably damaging	Het
Serpini2	T	C	3: 75,165,475 (GRCm39)	E168G	probably benign	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Sis	A	G	3: 72,819,237 (GRCm39)	S1440P	probably benign	Het
Snrnp40	A	G	4: 130,278,344 (GRCm39)	H283R	probably damaging	Het
Tcaf2	G	T	6: 42,607,298 (GRCm39)	Q219K	possibly damaging	Het
Tenm3	C	T	8: 48,740,988 (GRCm39)	R803H	probably damaging	Het
Ugt2b5	T	C	5: 87,287,465 (GRCm39)	D234G	probably damaging	Het
Unc13d	A	G	11: 115,959,514 (GRCm39)	F653S	probably damaging	Het
Unc93b1	A	G	19: 3,986,373 (GRCm39)	I136V	possibly damaging	Het
Utp20	A	G	10: 88,656,753 (GRCm39)	S151P	possibly damaging	Het
Vmn2r50	C	A	7: 9,787,026 (GRCm39)	W27L	probably benign	Het
Zan	T	C	5: 137,436,836 (GRCm39)	S2006G	unknown	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73,036,461 (GRCm39)	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73,004,520 (GRCm39)	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73,013,974 (GRCm39)	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73,010,263 (GRCm39)	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73,010,204 (GRCm39)	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73,002,585 (GRCm39)	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73,006,963 (GRCm39)	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73,009,010 (GRCm39)	missense	probably benign	0.29
IGL02149:Itgae	APN	11	72,994,720 (GRCm39)	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73,024,844 (GRCm39)	missense	probably benign	0.06
IGL02231:Itgae	APN	11	72,981,448 (GRCm39)	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73,009,361 (GRCm39)	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73,008,947 (GRCm39)	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73,021,777 (GRCm39)	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73,009,331 (GRCm39)	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73,009,029 (GRCm39)	splice site	probably benign
IGL02859:Itgae	APN	11	73,005,693 (GRCm39)	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73,016,136 (GRCm39)	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73,004,427 (GRCm39)	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73,024,680 (GRCm39)	splice site	probably null
IGL03352:Itgae	APN	11	73,022,556 (GRCm39)	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73,021,825 (GRCm39)	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73,008,973 (GRCm39)	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73,014,009 (GRCm39)	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73,005,733 (GRCm39)	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73,029,335 (GRCm39)	nonsense	probably null
R1231:Itgae	UTSW	11	73,010,205 (GRCm39)	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73,016,188 (GRCm39)	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73,006,418 (GRCm39)	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73,036,431 (GRCm39)	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73,007,988 (GRCm39)	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R1915:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R2061:Itgae	UTSW	11	73,009,448 (GRCm39)	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73,036,395 (GRCm39)	missense	probably benign	0.00
R2680:Itgae	UTSW	11	73,005,752 (GRCm39)	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73,031,513 (GRCm39)	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73,004,442 (GRCm39)	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73,002,165 (GRCm39)	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73,002,960 (GRCm39)	missense	probably benign
R4212:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4213:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4691:Itgae	UTSW	11	73,010,345 (GRCm39)	nonsense	probably null
R4736:Itgae	UTSW	11	73,005,706 (GRCm39)	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73,021,821 (GRCm39)	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73,001,382 (GRCm39)	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73,036,464 (GRCm39)	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73,002,675 (GRCm39)	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73,024,734 (GRCm39)	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73,020,074 (GRCm39)	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73,036,377 (GRCm39)	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73,031,583 (GRCm39)	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73,036,427 (GRCm39)	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73,022,519 (GRCm39)	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73,002,228 (GRCm39)	splice site	probably null
R6502:Itgae	UTSW	11	73,036,418 (GRCm39)	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73,009,322 (GRCm39)	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73,010,342 (GRCm39)	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73,002,195 (GRCm39)	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73,002,184 (GRCm39)	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73,031,504 (GRCm39)	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73,012,786 (GRCm39)	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73,004,457 (GRCm39)	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73,014,095 (GRCm39)	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73,029,618 (GRCm39)	missense	probably benign
R7860:Itgae	UTSW	11	73,011,099 (GRCm39)	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73,024,913 (GRCm39)	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73,011,210 (GRCm39)	missense	probably benign
R8911:Itgae	UTSW	11	73,004,447 (GRCm39)	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73,016,089 (GRCm39)	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73,012,752 (GRCm39)	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73,006,906 (GRCm39)	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73,002,629 (GRCm39)	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73,016,182 (GRCm39)	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73,011,171 (GRCm39)	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73,002,202 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1186:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1186:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1187:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1188:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1189:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1190:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1191:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1192:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- ATATCCTGCGGATTCAGTGC -3'
(R):5'- TGATGGACTACAAACTGTAAGCTG -3'

Sequencing Primer
(F):5'- GATTCAGTGCACCCCTGC -3'
(R):5'- AGCTGATAAGTTATTTCTCCACCAGC -3'

Posted On

2014-11-12