Mutagenetix > Incidental Mutations

Incidental Mutation 'R2436:Sacs'

249599

Institutional Source

Beutler Lab

Gene Symbol

Sacs

Ensembl Gene

ENSMUSG00000048279

Gene Name

sacsin

Synonyms

E130115J16Rik

MMRRC Submission

040397-MU

Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene?

Possibly non essential (E-score: 0.394) question?

Stock #

R2436 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61138457-61240695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 61202905 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 800 (D800V)

Ref Sequence

ENSEMBL: ENSMUSP00000113377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000227570] [ENSMUST00000229692]

Predicted Effect

probably benign
Transcript: ENSMUST00000089394

SMART Domains

Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119509

SMART Domains

Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
SCOP:d1byqa_	87	202	5e-3	SMART
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119943
AA Change: D800V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: D800V

Domain	Start	End	E-Value	Type
internal_repeat_1	61	514	1.35e-52	PROSPERO
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC
low complexity region	1019	1033	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1526	1537	N/A	INTRINSIC
low complexity region	2454	2463	N/A	INTRINSIC
internal_repeat_1	2475	2934	1.35e-52	PROSPERO
low complexity region	3751	3760	N/A	INTRINSIC
low complexity region	3997	4012	N/A	INTRINSIC
low complexity region	4285	4300	N/A	INTRINSIC
Blast:DnaJ	4304	4363	1e-31	BLAST
PDB:1IUR\|A	4309	4376	5e-39	PDB
SCOP:d1gh6a_	4317	4407	2e-3	SMART
HEPN	4454	4570	9.49e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150222

Predicted Effect

probably benign
Transcript: ENSMUST00000227570

Predicted Effect

probably benign
Transcript: ENSMUST00000229692

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	A	G	16: 56,761,945	S277P	possibly damaging	Het
Arl6ip4	T	C	5: 124,116,599	S52P	probably benign	Het
Barx2	T	C	9: 31,913,087	H2R	probably damaging	Het
Calhm3	T	C	19: 47,151,965	T230A	probably damaging	Het
Card11	C	T	5: 140,882,362	V844M	possibly damaging	Het
Dnah6	C	T	6: 73,149,173	R1327Q	probably benign	Het
Ehbp1	C	A	11: 22,089,524		probably null	Het
Fgg	T	A	3: 83,014,189	I393N	possibly damaging	Het
Foxq1	A	T	13: 31,558,533		probably benign	Het
Hmgxb3	T	C	18: 61,147,494	T646A	probably benign	Het
Homer3	G	A	8: 70,293,056	E324K	possibly damaging	Het
Krt80	A	G	15: 101,359,503	F183L	probably damaging	Het
Map3k21	A	T	8: 125,941,615	K647*	probably null	Het
Mcm3ap	A	G	10: 76,490,057	Y1067C	probably damaging	Het
Myh1	G	T	11: 67,213,271	Q921H	probably benign	Het
Nme8	A	G	13: 19,677,859	F200S	probably damaging	Het
Nploc4	T	C	11: 120,418,317	N153S	possibly damaging	Het
Olfr1246	A	G	2: 89,590,773	V114A	probably benign	Het
Olfr173	C	T	16: 58,797,244	V201I	probably benign	Het
Olfr297	T	C	7: 86,527,383	F209L	probably damaging	Het
Olfr319	T	C	11: 58,702,126	C142R	probably damaging	Het
Pipox	T	A	11: 77,892,117	L86F	probably damaging	Het
Polr3h	G	T	15: 81,917,205	L157I	probably benign	Het
Prex2	G	A	1: 11,266,152	V1525M	possibly damaging	Het
Rapgef2	A	T	3: 79,088,772	D561E	possibly damaging	Het
Sbsn	A	T	7: 30,752,230	L223F	possibly damaging	Het
Slc16a9	TCCCC	TCCCCC	10: 70,256,081		probably null	Het
Srrm3	G	T	5: 135,835,176	E43*	probably null	Het
Tcaf3	G	A	6: 42,593,729	A363V	probably damaging	Het
Tmem138	A	G	19: 10,574,904	F78S	probably damaging	Het
Tnfrsf17	G	A	16: 11,319,812	D138N	probably damaging	Het
Tubgcp6	C	T	15: 89,102,365	V1344I	probably benign	Het
Usp24	T	A	4: 106,409,645	L1875*	probably null	Het
Vmn2r109	C	A	17: 20,554,536	G186C	probably damaging	Het
Wdr78	T	C	4: 103,066,352	I427V	probably benign	Het
Zfp541	A	G	7: 16,076,448	N137D	possibly damaging	Het

Other mutations in Sacs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Sacs	APN	14	61191635	missense	possibly damaging	0.64
IGL01839:Sacs	APN	14	61183945	intron	probably benign
IGL02024:Sacs	APN	14	61189678	missense	probably damaging	0.96
IGL02247:Sacs	APN	14	61192535	missense	probably damaging	1.00
F6893:Sacs	UTSW	14	61212976	missense	probably benign
IGL03052:Sacs	UTSW	14	61207858	missense	probably damaging	0.99
R0090:Sacs	UTSW	14	61205440	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0390:Sacs	UTSW	14	61205640	missense	possibly damaging	0.92
R0479:Sacs	UTSW	14	61191479	missense	probably damaging	0.99
R0556:Sacs	UTSW	14	61183958	missense	probably damaging	0.99
R0673:Sacs	UTSW	14	61210215	missense	possibly damaging	0.89
R0748:Sacs	UTSW	14	61209265	missense	probably damaging	0.99
R0931:Sacs	UTSW	14	61203495	missense	probably benign
R0972:Sacs	UTSW	14	61211963	nonsense	probably null
R1281:Sacs	UTSW	14	61191801	missense	probably benign	0.02
R1340:Sacs	UTSW	14	61204509	missense	probably damaging	0.98
R1351:Sacs	UTSW	14	61202761	missense	probably benign	0.00
R1499:Sacs	UTSW	14	61213704	missense	possibly damaging	0.70
R1538:Sacs	UTSW	14	61210059	missense	probably damaging	0.98
R1581:Sacs	UTSW	14	61213679	missense	probably damaging	0.96
R1599:Sacs	UTSW	14	61203638	missense	probably benign
R1631:Sacs	UTSW	14	61210732	nonsense	probably null
R1635:Sacs	UTSW	14	61203828	missense	probably damaging	0.98
R1655:Sacs	UTSW	14	61191782	missense	probably benign
R1660:Sacs	UTSW	14	61209009	missense	probably damaging	0.99
R1707:Sacs	UTSW	14	61209762	missense	probably benign	0.01
R1733:Sacs	UTSW	14	61205454	missense	probably damaging	1.00
R1772:Sacs	UTSW	14	61210897	missense	probably damaging	1.00
R1976:Sacs	UTSW	14	61202895	missense	probably benign
R2055:Sacs	UTSW	14	61214049	missense	probably damaging	0.97
R2083:Sacs	UTSW	14	61206506	missense	possibly damaging	0.69
R2091:Sacs	UTSW	14	61191919	missense	possibly damaging	0.95
R2105:Sacs	UTSW	14	61173441	missense	possibly damaging	0.90
R2109:Sacs	UTSW	14	61173453	splice site	probably null
R2117:Sacs	UTSW	14	61213771	missense	probably benign	0.01
R2122:Sacs	UTSW	14	61212316	missense	probably damaging	1.00
R2148:Sacs	UTSW	14	61173378	missense	probably damaging	0.97
R2151:Sacs	UTSW	14	61209640	missense	probably damaging	1.00
R2231:Sacs	UTSW	14	61205929	unclassified	probably null
R2248:Sacs	UTSW	14	61212802	missense	probably damaging	1.00
R2271:Sacs	UTSW	14	61204660	missense	probably benign	0.06
R2314:Sacs	UTSW	14	61207759	missense	probably benign	0.17
R2445:Sacs	UTSW	14	61205206	missense	probably damaging	1.00
R2512:Sacs	UTSW	14	61203080	missense	probably benign	0.00
R3434:Sacs	UTSW	14	61212303	missense	probably damaging	1.00
R3785:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3786:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3796:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3798:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3872:Sacs	UTSW	14	61148068	missense	probably benign	0.30
R3873:Sacs	UTSW	14	61192286	missense	possibly damaging	0.64
R3892:Sacs	UTSW	14	61204387	missense	probably damaging	0.98
R4184:Sacs	UTSW	14	61213944	missense	probably damaging	0.97
R4204:Sacs	UTSW	14	61173443	missense	possibly damaging	0.93
R4249:Sacs	UTSW	14	61203457	missense	probably benign	0.02
R4256:Sacs	UTSW	14	61206337	missense	probably damaging	1.00
R4370:Sacs	UTSW	14	61212309	missense	probably damaging	1.00
R4445:Sacs	UTSW	14	61204686	missense	probably benign	0.30
R4503:Sacs	UTSW	14	61207603	missense	probably damaging	1.00
R4548:Sacs	UTSW	14	61191938	missense	probably damaging	1.00
R4582:Sacs	UTSW	14	61191698	missense	probably damaging	1.00
R4613:Sacs	UTSW	14	61211797	intron	probably null
R4639:Sacs	UTSW	14	61207268	missense	probably benign	0.12
R4697:Sacs	UTSW	14	61212747	missense	probably benign	0.19
R4706:Sacs	UTSW	14	61204273	missense	probably damaging	1.00
R4717:Sacs	UTSW	14	61212855	missense	probably damaging	1.00
R4777:Sacs	UTSW	14	61211809	missense	probably damaging	1.00
R4888:Sacs	UTSW	14	61212198	missense	probably damaging	1.00
R4913:Sacs	UTSW	14	61213797	missense	probably benign	0.17
R4973:Sacs	UTSW	14	61213122	missense	probably damaging	1.00
R4986:Sacs	UTSW	14	61213043	nonsense	probably null
R5090:Sacs	UTSW	14	61205253	missense	probably damaging	1.00
R5243:Sacs	UTSW	14	61205957	nonsense	probably null
R5292:Sacs	UTSW	14	61211983	missense	probably damaging	1.00
R5308:Sacs	UTSW	14	61192400	missense	probably benign	0.21
R5337:Sacs	UTSW	14	61193514	intron	probably benign
R5502:Sacs	UTSW	14	61206100	missense	probably damaging	1.00
R5586:Sacs	UTSW	14	61206441	nonsense	probably null
R5692:Sacs	UTSW	14	61207839	missense	probably benign	0.00
R5725:Sacs	UTSW	14	61211110	missense	probably damaging	1.00
R5854:Sacs	UTSW	14	61211547	missense	probably damaging	1.00
R5959:Sacs	UTSW	14	61212400	missense	probably damaging	0.99
R5960:Sacs	UTSW	14	61208695	missense	probably benign	0.30
R5968:Sacs	UTSW	14	61189629	missense	probably damaging	0.99
R5983:Sacs	UTSW	14	61205199	missense	probably damaging	1.00
R5992:Sacs	UTSW	14	61205543	missense	probably damaging	1.00
R6076:Sacs	UTSW	14	61204536	nonsense	probably null
R6175:Sacs	UTSW	14	61212826	missense	possibly damaging	0.82
R6347:Sacs	UTSW	14	61211160	missense	probably damaging	1.00
R6357:Sacs	UTSW	14	61208824	missense	possibly damaging	0.47
R6415:Sacs	UTSW	14	61205359	missense	probably damaging	1.00
R6469:Sacs	UTSW	14	61191248	missense	probably damaging	1.00
R6503:Sacs	UTSW	14	61211361	missense	probably benign	0.00
R6523:Sacs	UTSW	14	61202961	missense	probably damaging	0.99
R6615:Sacs	UTSW	14	61208934	missense	probably benign	0.15
R6729:Sacs	UTSW	14	61210518	missense	probably damaging	1.00
R6797:Sacs	UTSW	14	61213073	missense	probably damaging	1.00
R6852:Sacs	UTSW	14	61179288	missense	possibly damaging	0.87
R6922:Sacs	UTSW	14	61211425	missense	probably damaging	1.00
X0067:Sacs	UTSW	14	61208019	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCATGTACTCAGCTGCAG -3'
(R):5'- CAAGTGGATGCTGAATAGAGGTATC -3'

Sequencing Primer
(F):5'- CAGCTTCTAAATCCAGAGCGATTTGC -3'
(R):5'- GGTATCTAGTCTTTTCAGGACAATCC -3'

Posted On

2014-11-12