Incidental Mutation 'R2437:Ptch1'
ID249681
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission 040398-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2437 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 63524959 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 944 (E944A)
Ref Sequence ENSEMBL: ENSMUSP00000021921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: E944A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: E944A

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192155
AA Change: E807A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: E807A

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195258
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,946,618 *635W probably null Het
4921507P07Rik T A 6: 50,583,979 D212V probably damaging Het
4932438A13Rik T A 3: 36,958,685 probably null Het
Anxa2 A G 9: 69,489,764 Y317C probably damaging Het
Arhgef26 T C 3: 62,432,581 S675P probably damaging Het
Camk2d A G 3: 126,834,628 N53S probably damaging Het
Carns1 A T 19: 4,165,783 M800K possibly damaging Het
Ces1f A T 8: 93,270,139 probably null Het
Chrne T A 11: 70,615,260 D426V possibly damaging Het
Cntfr T C 4: 41,671,035 T43A probably damaging Het
Cntn5 A T 9: 10,048,753 C63* probably null Het
Col12a1 G A 9: 79,692,219 T884I probably damaging Het
Dnah5 T C 15: 28,307,391 probably null Het
Dnajc2 A T 5: 21,760,391 S537R probably benign Het
Dnajc25 T C 4: 59,020,234 I100T probably damaging Het
Ephx1 C A 1: 180,996,096 G149C probably damaging Het
Fam163b G T 2: 27,112,686 P100T probably damaging Het
Fgd5 A T 6: 92,062,869 R1017* probably null Het
Fibin A T 2: 110,362,503 L98Q probably damaging Het
Fndc3b A T 3: 27,451,332 L929H probably damaging Het
Frem1 T A 4: 83,000,173 S512C probably damaging Het
Gm4922 T A 10: 18,784,081 M298L probably benign Het
Gstm2 G A 3: 107,984,053 probably benign Het
Gtf3c2 A G 5: 31,159,698 probably null Het
Ibtk A C 9: 85,708,125 L1026V probably benign Het
Il9 T A 13: 56,481,871 probably benign Het
Inpp4a T C 1: 37,392,956 S146P probably damaging Het
Kcnab1 G T 3: 65,357,014 probably benign Het
Lrrc29 A G 8: 105,313,043 probably null Het
Mgat4c T C 10: 102,388,575 S217P probably damaging Het
Mr1 T C 1: 155,132,531 M233V probably benign Het
Ncoa2 G A 1: 13,148,360 T1415I probably damaging Het
Oasl2 G A 5: 114,911,296 D486N probably benign Het
Olfr1412 T C 1: 92,588,966 I212T possibly damaging Het
Olfr342 A T 2: 36,528,246 Y278F probably damaging Het
Olfr461 G A 6: 40,544,922 T19I probably benign Het
Pcnx4 T C 12: 72,541,813 F132L probably damaging Het
Pde5a T A 3: 122,843,053 L717Q probably damaging Het
Peli2 A T 14: 48,227,932 probably benign Het
Phf14 A G 6: 11,962,658 S435G probably damaging Het
Plekhg1 T A 10: 3,963,564 H1095Q probably damaging Het
Plekhh2 A G 17: 84,586,479 probably null Het
Plekho1 T G 3: 95,992,185 N99H probably damaging Het
Plxnc1 T A 10: 94,906,533 K457N probably benign Het
Ppp1r3a T C 6: 14,718,323 E864G probably benign Het
Prkab2 T A 3: 97,667,399 L237Q probably damaging Het
Ptger3 T A 3: 157,567,570 C185S probably damaging Het
Ptprk T C 10: 28,354,713 Y267H probably damaging Het
Pum2 A G 12: 8,744,654 I715V probably benign Het
R3hdm1 T C 1: 128,186,836 V518A probably damaging Het
Rab3d T C 9: 21,915,851 I28V probably damaging Het
Rad54b T C 4: 11,606,272 L560P probably damaging Het
Rgs20 A G 1: 5,070,147 probably null Het
Sesn1 T A 10: 41,905,319 L460H probably damaging Het
Slc39a14 A G 14: 70,316,436 probably null Het
Slco6c1 T A 1: 97,062,476 H663L probably benign Het
Snx13 T A 12: 35,082,927 C63S probably benign Het
Strip2 T C 6: 29,941,941 probably null Het
Syncrip A G 9: 88,479,567 probably benign Het
Taf15 A G 11: 83,504,753 probably benign Het
Tbc1d8 T C 1: 39,405,287 probably null Het
Tgm4 T A 9: 123,048,549 C205* probably null Het
Tmem212 A T 3: 27,886,479 L63Q possibly damaging Het
Tmem63a G A 1: 180,962,489 probably null Het
Trpm5 C A 7: 143,082,561 V525L probably benign Het
Ttn A G 2: 76,706,827 L34919P probably damaging Het
Ttn T C 2: 76,864,275 probably benign Het
Tuba4a T C 1: 75,217,425 I4V possibly damaging Het
Ubr4 A G 4: 139,473,542 D4679G possibly damaging Het
Usp2 T G 9: 44,092,148 V448G probably damaging Het
Usp3 A G 9: 66,545,742 probably null Het
Zfp341 T A 2: 154,628,801 V246E probably damaging Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AACGCTCACTTCTCAACGTG -3'
(R):5'- TGTAGTTGACTAAACAGCGTCTGG -3'

Sequencing Primer
(F):5'- GCAGGGCTGTGTTCCATTACAC -3'
(R):5'- GTAGACGCAGATGGCATCATTAATCC -3'
Posted On2014-11-12