Incidental Mutation 'R2438:Myo1g'
ID249703
Institutional Source Beutler Lab
Gene Symbol Myo1g
Ensembl Gene ENSMUSG00000020437
Gene Namemyosin IG
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2438 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6506548-6520965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6511542 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 636 (N636K)
Ref Sequence ENSEMBL: ENSMUSP00000003459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003459] [ENSMUST00000144725]
Predicted Effect probably damaging
Transcript: ENSMUST00000003459
AA Change: N636K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003459
Gene: ENSMUSG00000020437
AA Change: N636K

DomainStartEndE-ValueType
MYSc 9 714 N/A SMART
IQ 715 737 2.79e0 SMART
Pfam:Myosin_TH1 821 1024 2.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134639
Predicted Effect probably benign
Transcript: ENSMUST00000144725
SMART Domains Protein: ENSMUSP00000120975
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Blast:MYSc 9 43 8e-14 BLAST
low complexity region 48 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156878
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYO1G is a plasma membrane-associated class I myosin (see MIM 601478) that is abundant in T and B lymphocytes and mast cells (Pierce et al., 2001 [PubMed 11544309]; Patino-Lopez et al., 2010 [PubMed 20071333]).[supplied by OMIM, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced B cell spreading, migration and homing and impaired T cell motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik T C 9: 22,431,683 V291A probably damaging Het
Acap2 A G 16: 31,117,315 V318A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd8b1 A G 6: 71,329,756 K156E probably damaging Het
Ckap5 T C 2: 91,595,408 M1262T possibly damaging Het
Crebbp A G 16: 4,154,858 M324T possibly damaging Het
Cwf19l1 G A 19: 44,110,563 R523C probably benign Het
Defb21 A T 2: 152,574,775 Y57F possibly damaging Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Gfpt1 A T 6: 87,057,745 E175V probably null Het
Gga1 T C 15: 78,885,298 F157S probably damaging Het
Impdh2 A T 9: 108,560,616 D28V probably benign Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Krt5 T C 15: 101,711,658 N208S probably benign Het
Myo15 A T 11: 60,483,052 I1242F probably damaging Het
Nrros T C 16: 32,144,111 probably null Het
Nrros C T 16: 32,144,299 G264D probably benign Het
Nsun4 A G 4: 116,048,597 V54A probably benign Het
Olfr1299 A T 2: 111,664,751 D175V probably damaging Het
Olfr1458 A T 19: 13,102,421 D294E probably benign Het
Pilrb2 T A 5: 137,870,913 I142L probably benign Het
Ryr2 A G 13: 11,801,848 S596P probably damaging Het
Sema5a G T 15: 32,550,253 S146I possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc43a2 A T 11: 75,563,131 E290V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Zfp456 A T 13: 67,366,954 I211N probably damaging Het
Other mutations in Myo1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Myo1g APN 11 6515856 missense possibly damaging 0.70
IGL01608:Myo1g APN 11 6516780 missense possibly damaging 0.61
IGL01679:Myo1g APN 11 6518006 missense possibly damaging 0.90
IGL01830:Myo1g APN 11 6514522 nonsense probably null
IGL02332:Myo1g APN 11 6520766 missense possibly damaging 0.61
IGL02813:Myo1g APN 11 6518743 makesense probably null
IGL02988:Myo1g APN 11 6508183 splice site probably benign
IGL03178:Myo1g APN 11 6512181 missense probably damaging 1.00
R0004:Myo1g UTSW 11 6515901 missense probably damaging 1.00
R0334:Myo1g UTSW 11 6511084 splice site probably benign
R0513:Myo1g UTSW 11 6510203 missense probably benign 0.00
R0730:Myo1g UTSW 11 6520794 missense probably damaging 1.00
R1054:Myo1g UTSW 11 6518987 missense probably damaging 1.00
R1434:Myo1g UTSW 11 6509372 missense probably benign 0.00
R1500:Myo1g UTSW 11 6520811 missense probably benign
R1513:Myo1g UTSW 11 6515140 missense probably damaging 0.99
R1720:Myo1g UTSW 11 6512490 missense probably benign 0.44
R1774:Myo1g UTSW 11 6515988 missense probably damaging 1.00
R1809:Myo1g UTSW 11 6512283 missense probably benign 0.02
R1957:Myo1g UTSW 11 6512159 critical splice donor site probably null
R1978:Myo1g UTSW 11 6520829 missense possibly damaging 0.53
R2212:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R2566:Myo1g UTSW 11 6512539 critical splice acceptor site probably null
R3158:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3159:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3413:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R3816:Myo1g UTSW 11 6510926 missense probably benign 0.02
R3872:Myo1g UTSW 11 6514886 missense possibly damaging 0.94
R3946:Myo1g UTSW 11 6520760 missense possibly damaging 0.89
R4551:Myo1g UTSW 11 6517874 missense probably damaging 1.00
R4625:Myo1g UTSW 11 6512240 missense probably damaging 1.00
R4630:Myo1g UTSW 11 6519047 missense probably damaging 1.00
R4700:Myo1g UTSW 11 6516785 unclassified probably null
R4713:Myo1g UTSW 11 6516080 missense probably null 1.00
R4964:Myo1g UTSW 11 6515976 missense probably damaging 1.00
R5183:Myo1g UTSW 11 6508243 missense probably damaging 1.00
R5191:Myo1g UTSW 11 6515105 missense probably benign
R5192:Myo1g UTSW 11 6514816 missense probably damaging 1.00
R5726:Myo1g UTSW 11 6509420 missense probably benign 0.06
R5841:Myo1g UTSW 11 6507000 missense probably benign 0.05
R5942:Myo1g UTSW 11 6514888 missense probably damaging 1.00
R6225:Myo1g UTSW 11 6519168 missense probably damaging 1.00
R6517:Myo1g UTSW 11 6512509 missense probably damaging 0.99
R6563:Myo1g UTSW 11 6517146 missense possibly damaging 0.91
X0017:Myo1g UTSW 11 6516077 critical splice donor site probably null
X0061:Myo1g UTSW 11 6517967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACAGACATTTTGTTGCCTTGG -3'
(R):5'- TCTTAGGGACCTGAGAAGCC -3'

Sequencing Primer
(F):5'- GAGGTGCACTGGCCCTAAC -3'
(R):5'- ACCTGAGAAGCCCTGGC -3'
Posted On2014-11-12