Incidental Mutation 'R2438:Ebf2'
ID249708
Institutional Source Beutler Lab
Gene Symbol Ebf2
Ensembl Gene ENSMUSG00000022053
Gene Nameearly B cell factor 2
SynonymsMmot1, D14Ggc1e, O/E-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R2438 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67233292-67430918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67387942 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 233 (V233D)
Ref Sequence ENSEMBL: ENSMUSP00000135500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022637] [ENSMUST00000176029] [ENSMUST00000176161]
Predicted Effect probably damaging
Transcript: ENSMUST00000022637
AA Change: V233D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022637
Gene: ENSMUSG00000022053
AA Change: V233D

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176029
AA Change: V233D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135782
Gene: ENSMUSG00000022053
AA Change: V233D

DomainStartEndE-ValueType
Pfam:COE1_DBD 16 246 2.3e-145 PFAM
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176161
AA Change: V233D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135500
Gene: ENSMUSG00000022053
AA Change: V233D

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176841
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the COE (Collier/Olf/EBF) family of non-basic, helix-loop-helix transcription factors that have a well conserved DNA binding domain. The COE family proteins play an important role in variety of developmental processes. Studies in mouse suggest that this gene may be involved in the differentiation of osteoblasts. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants show decreased viability, impaired olfactory neuron projection, and impaired mating, more so in male mice. Mice homozygous for another knock-out allele exhibit narcolepsy-cataplexy syndrome and decreased orexinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik T C 9: 22,431,683 V291A probably damaging Het
Acap2 A G 16: 31,117,315 V318A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd8b1 A G 6: 71,329,756 K156E probably damaging Het
Ckap5 T C 2: 91,595,408 M1262T possibly damaging Het
Crebbp A G 16: 4,154,858 M324T possibly damaging Het
Cwf19l1 G A 19: 44,110,563 R523C probably benign Het
Defb21 A T 2: 152,574,775 Y57F possibly damaging Het
Gfpt1 A T 6: 87,057,745 E175V probably null Het
Gga1 T C 15: 78,885,298 F157S probably damaging Het
Impdh2 A T 9: 108,560,616 D28V probably benign Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Krt5 T C 15: 101,711,658 N208S probably benign Het
Myo15 A T 11: 60,483,052 I1242F probably damaging Het
Myo1g A T 11: 6,511,542 N636K probably damaging Het
Nrros T C 16: 32,144,111 probably null Het
Nrros C T 16: 32,144,299 G264D probably benign Het
Nsun4 A G 4: 116,048,597 V54A probably benign Het
Olfr1299 A T 2: 111,664,751 D175V probably damaging Het
Olfr1458 A T 19: 13,102,421 D294E probably benign Het
Pilrb2 T A 5: 137,870,913 I142L probably benign Het
Ryr2 A G 13: 11,801,848 S596P probably damaging Het
Sema5a G T 15: 32,550,253 S146I possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc43a2 A T 11: 75,563,131 E290V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Zfp456 A T 13: 67,366,954 I211N probably damaging Het
Other mutations in Ebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ebf2 APN 14 67239478 missense probably damaging 1.00
IGL01808:Ebf2 APN 14 67414483 missense probably benign 0.01
IGL02087:Ebf2 APN 14 67428096 missense probably benign 0.03
IGL02094:Ebf2 APN 14 67235240 missense possibly damaging 0.80
IGL02270:Ebf2 APN 14 67238953 missense probably damaging 1.00
IGL03222:Ebf2 APN 14 67411992 splice site probably null
IGL03390:Ebf2 APN 14 67424109 missense probably benign 0.19
R0044:Ebf2 UTSW 14 67310968 intron probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0505:Ebf2 UTSW 14 67371736 nonsense probably null
R2103:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R3789:Ebf2 UTSW 14 67239493 critical splice donor site probably null
R4153:Ebf2 UTSW 14 67235223 missense probably damaging 1.00
R4348:Ebf2 UTSW 14 67239422 missense probably damaging 0.99
R4793:Ebf2 UTSW 14 67410082 missense probably damaging 1.00
R4991:Ebf2 UTSW 14 67389657 missense possibly damaging 0.87
R5164:Ebf2 UTSW 14 67390521 missense possibly damaging 0.94
R5222:Ebf2 UTSW 14 67313594 intron probably benign
R5227:Ebf2 UTSW 14 67247069 missense probably damaging 0.99
R5459:Ebf2 UTSW 14 67235201 missense probably benign 0.34
R5622:Ebf2 UTSW 14 67390558 missense possibly damaging 0.91
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6265:Ebf2 UTSW 14 67424060 missense probably benign 0.00
R6893:Ebf2 UTSW 14 67237559 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGACTCCAAAATTTTGCCTCG -3'
(R):5'- AGCAGCACTTAGAAATGCCC -3'

Sequencing Primer
(F):5'- GTCTCTCACTTGCCTTGCAGAAATG -3'
(R):5'- TTGCTTAGCATACAGGAAGTCCC -3'
Posted On2014-11-12