Incidental Mutation 'R2439:2210407C18Rik'
ID249735
Institutional Source Beutler Lab
Gene Symbol 2210407C18Rik
Ensembl Gene ENSMUSG00000037145
Gene NameRIKEN cDNA 2210407C18 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R2439 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58608204-58616075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58610777 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 127 (C127R)
Ref Sequence ENSEMBL: ENSMUSP00000104449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048801] [ENSMUST00000108821]
Predicted Effect probably damaging
Transcript: ENSMUST00000048801
AA Change: C127R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039283
Gene: ENSMUSG00000037145
AA Change: C127R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108821
AA Change: C127R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104449
Gene: ENSMUSG00000037145
AA Change: C127R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126695
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11b C A 3: 35,814,084 T635K possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Btla G T 16: 45,239,140 C69F probably damaging Het
Cdh10 T G 15: 19,013,398 L695V probably damaging Het
Cfap44 C T 16: 44,481,246 probably benign Het
Dock10 T G 1: 80,532,432 N1560H probably damaging Het
Ephb6 C A 6: 41,618,735 H809Q probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Gdf7 A G 12: 8,298,050 S416P probably damaging Het
Ints8 T C 4: 11,225,725 M611V probably benign Het
Micalcl A G 7: 112,394,795 E504G probably damaging Het
Mrps30 G A 13: 118,385,272 P231S probably damaging Het
Nr1h3 T C 2: 91,190,220 D256G probably benign Het
Pramel5 T C 4: 144,273,740 M89V probably benign Het
Psg18 T C 7: 18,346,119 T386A probably benign Het
Ptprc A G 1: 138,066,152 V1180A possibly damaging Het
Rassf8 T C 6: 145,815,334 S129P probably damaging Het
Rbm6 A G 9: 107,779,597 Y994H probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc2a4 A G 11: 69,945,625 F222S possibly damaging Het
Smarca2 T C 19: 26,691,454 probably null Het
Tmtc4 T G 14: 122,971,903 N110T probably damaging Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Umad1 T A 6: 8,427,078 D110E probably damaging Het
Ylpm1 A G 12: 85,014,117 probably benign Het
Other mutations in 2210407C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:2210407C18Rik APN 11 58612881 utr 5 prime probably benign
IGL02341:2210407C18Rik APN 11 58612830 missense possibly damaging 0.70
IGL02609:2210407C18Rik APN 11 58612616 missense probably damaging 1.00
R0466:2210407C18Rik UTSW 11 58612505 splice site probably benign
R0598:2210407C18Rik UTSW 11 58608404 missense probably benign 0.27
R0612:2210407C18Rik UTSW 11 58611973 splice site probably null
R2352:2210407C18Rik UTSW 11 58612108 nonsense probably null
R2352:2210407C18Rik UTSW 11 58612850 missense probably damaging 1.00
R2910:2210407C18Rik UTSW 11 58608426 nonsense probably null
R2911:2210407C18Rik UTSW 11 58608426 nonsense probably null
R2991:2210407C18Rik UTSW 11 58610690 missense possibly damaging 0.81
R3609:2210407C18Rik UTSW 11 58612558 missense possibly damaging 0.95
R4863:2210407C18Rik UTSW 11 58612512 critical splice donor site probably null
R4925:2210407C18Rik UTSW 11 58610687 missense probably damaging 0.96
R6954:2210407C18Rik UTSW 11 58608488 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCTGAGCATCTGAAGGAC -3'
(R):5'- AGCTCATCCTCACTGCAACG -3'

Sequencing Primer
(F):5'- GCCAGTGACATGCTCAGATTCTAG -3'
(R):5'- CACTGCAACGCTTTTTGGTAGAATC -3'
Posted On2014-11-12