Incidental Mutation 'R2439:Mrps30'
ID249740
Institutional Source Beutler Lab
Gene Symbol Mrps30
Ensembl Gene ENSMUSG00000021731
Gene Namemitochondrial ribosomal protein S30
Synonyms2610020A16Rik, Pdcd9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R2439 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location118378381-118387252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118385272 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 231 (P231S)
Ref Sequence ENSEMBL: ENSMUSP00000022245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022245] [ENSMUST00000181168]
Predicted Effect probably damaging
Transcript: ENSMUST00000022245
AA Change: P231S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022245
Gene: ENSMUSG00000021731
AA Change: P231S

DomainStartEndE-ValueType
Pfam:PDCD9 1 423 1.7e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181168
SMART Domains Protein: ENSMUSP00000137680
Gene: ENSMUSG00000097411

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225170
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that is similar to the chicken pro-apoptotic protein p52. Transcript variants using alternative promoters or polyA sites have been mentioned in the literature but the complete description of these sequences is not available. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,610,777 C127R probably damaging Het
Atp11b C A 3: 35,814,084 T635K possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Btla G T 16: 45,239,140 C69F probably damaging Het
Cdh10 T G 15: 19,013,398 L695V probably damaging Het
Cfap44 C T 16: 44,481,246 probably benign Het
Dock10 T G 1: 80,532,432 N1560H probably damaging Het
Ephb6 C A 6: 41,618,735 H809Q probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Gdf7 A G 12: 8,298,050 S416P probably damaging Het
Ints8 T C 4: 11,225,725 M611V probably benign Het
Micalcl A G 7: 112,394,795 E504G probably damaging Het
Nr1h3 T C 2: 91,190,220 D256G probably benign Het
Pramel5 T C 4: 144,273,740 M89V probably benign Het
Psg18 T C 7: 18,346,119 T386A probably benign Het
Ptprc A G 1: 138,066,152 V1180A possibly damaging Het
Rassf8 T C 6: 145,815,334 S129P probably damaging Het
Rbm6 A G 9: 107,779,597 Y994H probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc2a4 A G 11: 69,945,625 F222S possibly damaging Het
Smarca2 T C 19: 26,691,454 probably null Het
Tmtc4 T G 14: 122,971,903 N110T probably damaging Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Umad1 T A 6: 8,427,078 D110E probably damaging Het
Ylpm1 A G 12: 85,014,117 probably benign Het
Other mutations in Mrps30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Mrps30 APN 13 118380610 missense probably damaging 1.00
R0030:Mrps30 UTSW 13 118382995 missense possibly damaging 0.94
R2764:Mrps30 UTSW 13 118384588 missense probably benign 0.03
R4030:Mrps30 UTSW 13 118380541 missense probably damaging 1.00
R4231:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4232:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4234:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4235:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4236:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4625:Mrps30 UTSW 13 118386714 missense probably benign 0.14
R4935:Mrps30 UTSW 13 118386895 missense possibly damaging 0.82
R5363:Mrps30 UTSW 13 118387162 missense probably benign 0.39
R5986:Mrps30 UTSW 13 118384565 critical splice donor site probably null
R6566:Mrps30 UTSW 13 118387126 missense probably benign 0.00
R6681:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6694:Mrps30 UTSW 13 118386961 missense possibly damaging 0.82
R6699:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6700:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6788:Mrps30 UTSW 13 118380372 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATAACACTCCAAACTAGAGAGTTG -3'
(R):5'- TCTTAGACATGCTGCTCATCAC -3'

Sequencing Primer
(F):5'- TGAAAAAGACTTCCAGAAAAGTTGCC -3'
(R):5'- GACATGCTGCTCATCACATGTTTATG -3'
Posted On2014-11-12