Incidental Mutation 'R2440:Lpgat1'
ID249748
Institutional Source Beutler Lab
Gene Symbol Lpgat1
Ensembl Gene ENSMUSG00000026623
Gene Namelysophosphatidylglycerol acyltransferase 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R2440 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191717834-191784255 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 191760209 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 269 (E269G)
Ref Sequence ENSEMBL: ENSMUSP00000106480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110855] [ENSMUST00000110856] [ENSMUST00000130876]
Predicted Effect probably benign
Transcript: ENSMUST00000110855
AA Change: E230G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106479
Gene: ENSMUSG00000026623
AA Change: E230G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
PlsC 95 219 2.16e-10 SMART
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110856
AA Change: E269G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106480
Gene: ENSMUSG00000026623
AA Change: E269G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
PlsC 134 258 2.16e-10 SMART
Pfam:Acyltransf_C 310 384 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130876
SMART Domains Protein: ENSMUSP00000114382
Gene: ENSMUSG00000026623

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
PlsC 95 219 2.16e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180108
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysophospholipid acyltransferase family. The encoded protein catalyzes the reacylation of lysophosphatidylglycerol to phosphatidylglycerol, a membrane phospholipid that is an important precursor for the synthesis of cardiolipin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 60,016,280 T104A probably benign Het
5830473C10Rik A G 5: 90,572,689 probably null Het
Adar A G 3: 89,734,854 H14R possibly damaging Het
Alcam T A 16: 52,305,613 M114L probably damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Coch T C 12: 51,596,562 S122P probably damaging Het
Cyp2c69 T C 19: 39,876,294 K247E probably benign Het
Gm1527 A G 3: 28,895,615 D8G probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Itga8 G A 2: 12,178,680 T751I possibly damaging Het
Kif5a A G 10: 127,231,336 V904A probably benign Het
Olfr536 T A 7: 140,503,552 K302N probably benign Het
Pde4d A G 13: 109,927,197 probably benign Het
Rita1 T C 5: 120,609,939 Y98C probably damaging Het
Surf1 A G 2: 26,913,907 probably null Het
Sv2c A G 13: 96,048,576 Y198H probably damaging Het
Svs3a T C 2: 164,289,631 F41L possibly damaging Het
Tigd2 A G 6: 59,209,995 probably benign Het
Tubb4a C A 17: 57,086,285 G38W probably damaging Het
Tyrp1 G A 4: 80,846,606 V7I probably benign Het
Unc45a A G 7: 80,329,057 Y615H probably damaging Het
Wisp1 T A 15: 66,912,857 D126E possibly damaging Het
Other mutations in Lpgat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpgat1 APN 1 191760209 missense probably benign 0.01
IGL01410:Lpgat1 APN 1 191776432 splice site probably null
R0324:Lpgat1 UTSW 1 191749642 missense probably damaging 1.00
R0386:Lpgat1 UTSW 1 191719348 splice site probably benign
R1568:Lpgat1 UTSW 1 191776426 missense possibly damaging 0.92
R1616:Lpgat1 UTSW 1 191763629 missense possibly damaging 0.96
R4087:Lpgat1 UTSW 1 191763616 missense possibly damaging 0.82
R4152:Lpgat1 UTSW 1 191719488 nonsense probably null
R4720:Lpgat1 UTSW 1 191763667 missense probably damaging 1.00
R4962:Lpgat1 UTSW 1 191719570 missense probably damaging 1.00
R5828:Lpgat1 UTSW 1 191776382 missense possibly damaging 0.53
R6343:Lpgat1 UTSW 1 191776572 intron probably null
R7326:Lpgat1 UTSW 1 191719453 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAACAGCTGCTGGTTCTCAAG -3'
(R):5'- ACTGACGGGTAGGAAAGTCATC -3'

Sequencing Primer
(F):5'- GCACCTTGAACATAATTACAGGAG -3'
(R):5'- GGTTTCTACAGTTCCAGGACAGC -3'
Posted On2014-11-12