Incidental Mutation 'R2440:Itga8'
ID249749
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Nameintegrin alpha 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R2440 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location12106632-12301922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12178680 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 751 (T751I)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028106
AA Change: T751I

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: T751I

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129370
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 60,016,280 T104A probably benign Het
5830473C10Rik A G 5: 90,572,689 probably null Het
Adar A G 3: 89,734,854 H14R possibly damaging Het
Alcam T A 16: 52,305,613 M114L probably damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Coch T C 12: 51,596,562 S122P probably damaging Het
Cyp2c69 T C 19: 39,876,294 K247E probably benign Het
Gm1527 A G 3: 28,895,615 D8G probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Kif5a A G 10: 127,231,336 V904A probably benign Het
Lpgat1 A G 1: 191,760,209 E269G probably benign Het
Olfr536 T A 7: 140,503,552 K302N probably benign Het
Pde4d A G 13: 109,927,197 probably benign Het
Rita1 T C 5: 120,609,939 Y98C probably damaging Het
Surf1 A G 2: 26,913,907 probably null Het
Sv2c A G 13: 96,048,576 Y198H probably damaging Het
Svs3a T C 2: 164,289,631 F41L possibly damaging Het
Tigd2 A G 6: 59,209,995 probably benign Het
Tubb4a C A 17: 57,086,285 G38W probably damaging Het
Tyrp1 G A 4: 80,846,606 V7I probably benign Het
Unc45a A G 7: 80,329,057 Y615H probably damaging Het
Wisp1 T A 15: 66,912,857 D126E possibly damaging Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12255966 nonsense probably null
IGL00820:Itga8 APN 2 12232892 missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12191714 missense probably benign
IGL01508:Itga8 APN 2 12232802 missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12160312 splice site probably benign
IGL01590:Itga8 APN 2 12160333 missense probably damaging 1.00
IGL01743:Itga8 APN 2 12265333 missense probably benign 0.04
IGL02634:Itga8 APN 2 12140478 missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12189480 missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12191199 missense probably benign 0.00
IGL03218:Itga8 APN 2 12111025 missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12132516 missense probably benign 0.20
R0196:Itga8 UTSW 2 12204729 critical splice donor site probably null
R0356:Itga8 UTSW 2 12182721 missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12232886 missense probably damaging 1.00
R0530:Itga8 UTSW 2 12191816 missense probably damaging 0.99
R0715:Itga8 UTSW 2 12191242 splice site probably benign
R0800:Itga8 UTSW 2 12193551 missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12262192 splice site probably null
R1675:Itga8 UTSW 2 12200163 missense probably damaging 0.99
R1758:Itga8 UTSW 2 12265333 missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12300846 missense probably damaging 1.00
R2187:Itga8 UTSW 2 12194420 missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12182709 missense probably benign 0.38
R2356:Itga8 UTSW 2 12200141 missense probably benign
R2371:Itga8 UTSW 2 12253466 missense probably damaging 1.00
R2412:Itga8 UTSW 2 12301715 missense probably benign
R2848:Itga8 UTSW 2 12160404 missense probably damaging 0.98
R3730:Itga8 UTSW 2 12193510 missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12189519 missense probably benign
R3982:Itga8 UTSW 2 12300963 missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4514:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4660:Itga8 UTSW 2 12265258 missense probably damaging 1.00
R4890:Itga8 UTSW 2 12193291 splice site probably benign
R5533:Itga8 UTSW 2 12160350 missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12265328 missense probably damaging 1.00
R5720:Itga8 UTSW 2 12111087 missense probably damaging 0.99
R5749:Itga8 UTSW 2 12262078 missense probably damaging 1.00
R5930:Itga8 UTSW 2 12230208 missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12132486 missense probably damaging 0.99
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6211:Itga8 UTSW 2 12193509 missense probably damaging 1.00
R6337:Itga8 UTSW 2 12253469 nonsense probably null
R6442:Itga8 UTSW 2 12230143 missense probably benign 0.00
R6491:Itga8 UTSW 2 12204776 missense probably damaging 1.00
R6543:Itga8 UTSW 2 12301644 missense probably damaging 0.99
R6574:Itga8 UTSW 2 12230161 missense probably benign 0.17
R6760:Itga8 UTSW 2 12301640 missense probably damaging 1.00
R6858:Itga8 UTSW 2 12200081 missense probably benign 0.00
R6943:Itga8 UTSW 2 12155371 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGACTATTTTACACCCTGGC -3'
(R):5'- TCAGTGCAGATGTCTTGCCTC -3'

Sequencing Primer
(F):5'- CACCCTGGCCTATATTATTTAATCAC -3'
(R):5'- AGATGTCTTGCCTCCCAGAC -3'
Posted On2014-11-12