Incidental Mutation 'R2443:5330417C22Rik'
ID249859
Institutional Source Beutler Lab
Gene Symbol 5330417C22Rik
Ensembl Gene ENSMUSG00000040412
Gene NameRIKEN cDNA 5330417C22 gene
Synonyms
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108455694-108536536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108481349 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 239 (N239K)
Ref Sequence ENSEMBL: ENSMUSP00000102237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048012] [ENSMUST00000106625] [ENSMUST00000106626] [ENSMUST00000185128]
Predicted Effect probably damaging
Transcript: ENSMUST00000048012
AA Change: N137K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040128
Gene: ENSMUSG00000040412
AA Change: N137K

DomainStartEndE-ValueType
internal_repeat_1 3 212 1.11e-6 PROSPERO
internal_repeat_1 289 522 1.11e-6 PROSPERO
transmembrane domain 806 828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106625
AA Change: N239K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102236
Gene: ENSMUSG00000040412
AA Change: N239K

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 310 8.31e-11 PROSPERO
internal_repeat_1 325 620 8.31e-11 PROSPERO
transmembrane domain 904 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106626
AA Change: N239K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102237
Gene: ENSMUSG00000040412
AA Change: N239K

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 178 2.5e-7 PROSPERO
internal_repeat_1 275 421 2.5e-7 PROSPERO
transmembrane domain 854 876 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185128
SMART Domains Protein: ENSMUSP00000138870
Gene: ENSMUSG00000040412

DomainStartEndE-ValueType
low complexity region 25 31 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Expression of this gene is induced by estrogen and the encoded protein has been characterized as a transmembrane protein. The encoded protein has been found in to correlate with survival in certain carcinomas (PMID: 21102415) and may be important for cellular response to stress (PMID: 21072319). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Male homozygous mice are infertile. Microscopic analysis revealed defective spermatogenesis in the testis, and hypospermia and defective spermatozoa in the epididymides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in 5330417C22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:5330417C22Rik APN 3 108481312 missense possibly damaging 0.48
IGL02079:5330417C22Rik APN 3 108481359 missense possibly damaging 0.91
IGL02268:5330417C22Rik APN 3 108467797 missense probably benign 0.00
IGL02869:5330417C22Rik APN 3 108472866 missense probably benign 0.34
IGL02891:5330417C22Rik APN 3 108464392 missense probably benign 0.03
IGL03088:5330417C22Rik APN 3 108536358 missense probably damaging 1.00
IGL03345:5330417C22Rik APN 3 108492016 missense possibly damaging 0.68
IGL03398:5330417C22Rik APN 3 108461221 missense possibly damaging 0.94
IGL03138:5330417C22Rik UTSW 3 108471993 missense probably benign 0.08
R0325:5330417C22Rik UTSW 3 108461251 missense probably damaging 1.00
R0730:5330417C22Rik UTSW 3 108469535 missense probably benign 0.00
R0844:5330417C22Rik UTSW 3 108480963 splice site probably benign
R1646:5330417C22Rik UTSW 3 108462990 missense probably damaging 1.00
R1666:5330417C22Rik UTSW 3 108469997 missense probably benign 0.01
R1726:5330417C22Rik UTSW 3 108467868 missense possibly damaging 0.67
R2202:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2203:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2204:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2205:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2249:5330417C22Rik UTSW 3 108471410 nonsense probably null
R3965:5330417C22Rik UTSW 3 108458449 missense probably damaging 1.00
R4171:5330417C22Rik UTSW 3 108460943 missense probably benign 0.30
R4785:5330417C22Rik UTSW 3 108458227 utr 3 prime probably benign
R4810:5330417C22Rik UTSW 3 108470011 splice site probably benign
R4862:5330417C22Rik UTSW 3 108467833 missense probably benign
R4923:5330417C22Rik UTSW 3 108471968 critical splice donor site probably null
R5040:5330417C22Rik UTSW 3 108475001 missense probably damaging 1.00
R5153:5330417C22Rik UTSW 3 108472747 missense possibly damaging 0.75
R5405:5330417C22Rik UTSW 3 108467786 nonsense probably null
R5609:5330417C22Rik UTSW 3 108471415 missense probably damaging 0.96
R5663:5330417C22Rik UTSW 3 108492083 missense probably benign 0.00
R6194:5330417C22Rik UTSW 3 108465779 missense probably benign 0.05
R6303:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6304:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6381:5330417C22Rik UTSW 3 108481814 missense possibly damaging 0.52
R6676:5330417C22Rik UTSW 3 108469915 missense probably damaging 1.00
R6852:5330417C22Rik UTSW 3 108482338 missense probably damaging 1.00
X0022:5330417C22Rik UTSW 3 108459746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAGCCACCCCTAGGAAG -3'
(R):5'- TCGCTCCATTAGAGATGCTTGTAG -3'

Sequencing Primer
(F):5'- GTATAGACGATCAAAGCTTGAGCCC -3'
(R):5'- GCATATGATGCACGGATC -3'
Posted On2014-11-12