Incidental Mutation 'R2444:Hltf'
ID 249903
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Name helicase-like transcription factor
Synonyms Snf2l3, Smarca3, P113
MMRRC Submission 040402-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2444 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 20111975-20172654 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20118071 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 44 (N44K)
Ref Sequence ENSEMBL: ENSMUSP00000118775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
AlphaFold Q6PCN7
Predicted Effect probably benign
Transcript: ENSMUST00000002502
AA Change: N106K

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: N106K

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect possibly damaging
Transcript: ENSMUST00000143005
AA Change: N106K

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428
AA Change: N106K

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145853
AA Change: N44K

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428
AA Change: N44K

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154233
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 78,904,561 (GRCm39) D112E possibly damaging Het
Abca15 A G 7: 119,965,120 (GRCm39) Y794C probably damaging Het
Bicd2 T C 13: 49,532,500 (GRCm39) V362A probably benign Het
Cep126 G A 9: 8,101,307 (GRCm39) T409M probably damaging Het
Cep131 A G 11: 119,961,321 (GRCm39) F610S probably damaging Het
Cfap61 T C 2: 145,877,239 (GRCm39) probably null Het
Chd1l A G 3: 97,497,882 (GRCm39) Y320H probably damaging Het
Dnajc30 A G 5: 135,093,439 (GRCm39) D112G probably damaging Het
Dync2i1 T C 12: 116,196,289 (GRCm39) D486G possibly damaging Het
Fam184a A C 10: 53,517,045 (GRCm39) L410R probably damaging Het
Fat2 T C 11: 55,172,799 (GRCm39) N2638S probably damaging Het
Fgf15 A G 7: 144,453,429 (GRCm39) D134G probably benign Het
Flywch2 A T 17: 23,996,024 (GRCm39) S124R possibly damaging Het
Gabra5 G A 7: 57,058,623 (GRCm39) T375I probably benign Het
Gpat3 C T 5: 101,005,039 (GRCm39) P58L probably benign Het
Hoatz A G 9: 51,011,298 (GRCm39) probably null Het
Kcnb2 A T 1: 15,779,791 (GRCm39) N221I probably benign Het
Marco G A 1: 120,422,499 (GRCm39) T61M probably damaging Het
Med13 A G 11: 86,222,786 (GRCm39) I180T probably damaging Het
Mei1 C T 15: 81,997,142 (GRCm39) T626M probably damaging Het
Mtnr1a C T 8: 45,540,695 (GRCm39) Q219* probably null Het
Nav3 A G 10: 109,600,776 (GRCm39) S1284P probably benign Het
Or1j10 T C 2: 36,267,625 (GRCm39) V279A possibly damaging Het
Or7g30 T A 9: 19,352,311 (GRCm39) I34K possibly damaging Het
Pcdh9 T A 14: 94,124,227 (GRCm39) T648S probably benign Het
Proz A T 8: 13,111,027 (GRCm39) probably benign Het
Rec114 G T 9: 58,567,602 (GRCm39) A128E probably damaging Het
Rspry1 G T 8: 95,349,735 (GRCm39) G41V probably damaging Het
Sbf2 A T 7: 109,929,905 (GRCm39) M1388K probably benign Het
Spice1 C T 16: 44,186,931 (GRCm39) Q143* probably null Het
Tcstv3 A T 13: 120,779,365 (GRCm39) K88M probably damaging Het
Terb2 T A 2: 122,023,788 (GRCm39) probably null Het
Tmx3 A T 18: 90,558,307 (GRCm39) K453M probably damaging Het
Tnc T C 4: 63,933,200 (GRCm39) Y688C probably damaging Het
Tshz2 T G 2: 169,726,726 (GRCm39) S441A probably benign Het
Usp45 A T 4: 21,817,528 (GRCm39) M399L probably benign Het
Vmn2r82 A T 10: 79,213,702 (GRCm39) H96L possibly damaging Het
Wls G A 3: 159,612,867 (GRCm39) R261Q probably damaging Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20,159,796 (GRCm39) splice site probably benign
IGL01461:Hltf APN 3 20,154,103 (GRCm39) nonsense probably null
IGL01630:Hltf APN 3 20,137,068 (GRCm39) splice site probably benign
IGL01704:Hltf APN 3 20,137,910 (GRCm39) splice site probably benign
IGL02059:Hltf APN 3 20,160,621 (GRCm39) missense probably benign
IGL02105:Hltf APN 3 20,146,921 (GRCm39) missense probably damaging 1.00
IGL02156:Hltf APN 3 20,146,971 (GRCm39) missense possibly damaging 0.61
IGL02870:Hltf APN 3 20,154,037 (GRCm39) missense probably damaging 0.98
IGL02899:Hltf APN 3 20,153,981 (GRCm39) missense probably damaging 1.00
IGL02935:Hltf APN 3 20,123,215 (GRCm39) missense probably damaging 1.00
IGL02950:Hltf APN 3 20,130,736 (GRCm39) missense probably benign 0.07
IGL03082:Hltf APN 3 20,118,723 (GRCm39) splice site probably benign
snarky UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R0068:Hltf UTSW 3 20,113,254 (GRCm39) missense probably damaging 1.00
R0787:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R0905:Hltf UTSW 3 20,163,033 (GRCm39) critical splice donor site probably null
R0980:Hltf UTSW 3 20,145,665 (GRCm39) missense probably benign 0.00
R1741:Hltf UTSW 3 20,140,352 (GRCm39) missense probably damaging 1.00
R1748:Hltf UTSW 3 20,130,685 (GRCm39) missense probably benign 0.13
R1799:Hltf UTSW 3 20,159,855 (GRCm39) missense probably damaging 1.00
R1976:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R2171:Hltf UTSW 3 20,113,245 (GRCm39) missense probably damaging 1.00
R2395:Hltf UTSW 3 20,146,906 (GRCm39) missense probably benign 0.41
R3789:Hltf UTSW 3 20,123,211 (GRCm39) missense probably damaging 1.00
R3943:Hltf UTSW 3 20,146,908 (GRCm39) missense probably damaging 1.00
R4719:Hltf UTSW 3 20,118,865 (GRCm39) critical splice donor site probably null
R4793:Hltf UTSW 3 20,118,114 (GRCm39) missense possibly damaging 0.79
R5296:Hltf UTSW 3 20,162,276 (GRCm39) missense probably damaging 0.99
R5449:Hltf UTSW 3 20,123,247 (GRCm39) missense possibly damaging 0.92
R5492:Hltf UTSW 3 20,152,231 (GRCm39) splice site probably null
R6012:Hltf UTSW 3 20,113,098 (GRCm39) missense probably damaging 1.00
R6157:Hltf UTSW 3 20,130,660 (GRCm39) missense probably benign 0.13
R6254:Hltf UTSW 3 20,117,993 (GRCm39) missense possibly damaging 0.85
R6553:Hltf UTSW 3 20,126,558 (GRCm39) missense probably damaging 0.96
R6616:Hltf UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R6696:Hltf UTSW 3 20,119,470 (GRCm39) splice site probably null
R6761:Hltf UTSW 3 20,137,996 (GRCm39) critical splice donor site probably null
R6781:Hltf UTSW 3 20,152,330 (GRCm39) missense probably benign 0.00
R7241:Hltf UTSW 3 20,119,556 (GRCm39) missense probably benign 0.07
R7356:Hltf UTSW 3 20,163,534 (GRCm39) missense probably damaging 1.00
R7453:Hltf UTSW 3 20,136,916 (GRCm39) missense possibly damaging 0.81
R7765:Hltf UTSW 3 20,145,647 (GRCm39) missense probably benign 0.02
R7978:Hltf UTSW 3 20,146,968 (GRCm39) missense probably damaging 1.00
R8299:Hltf UTSW 3 20,136,986 (GRCm39) missense possibly damaging 0.73
R8547:Hltf UTSW 3 20,152,291 (GRCm39) missense probably damaging 1.00
R8857:Hltf UTSW 3 20,159,825 (GRCm39) missense probably damaging 0.98
R8859:Hltf UTSW 3 20,119,566 (GRCm39) nonsense probably null
R8926:Hltf UTSW 3 20,123,323 (GRCm39) critical splice donor site probably null
R8959:Hltf UTSW 3 20,136,936 (GRCm39) missense probably damaging 1.00
R9052:Hltf UTSW 3 20,152,246 (GRCm39) missense probably damaging 1.00
R9214:Hltf UTSW 3 20,140,280 (GRCm39) missense probably benign 0.01
R9405:Hltf UTSW 3 20,137,094 (GRCm39) missense possibly damaging 0.88
R9565:Hltf UTSW 3 20,136,996 (GRCm39) critical splice donor site probably null
X0027:Hltf UTSW 3 20,121,553 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGGGCGAATGAATCTTACAGTAG -3'
(R):5'- TATTAGGAGCCATGACACTTCCAG -3'

Sequencing Primer
(F):5'- ACGTGAGACTCTGTTCCAAG -3'
(R):5'- ACTTCCAGGGGCTCCAAAAGTG -3'
Posted On 2014-11-12