Incidental Mutation 'R2444:Olfr849'
ID249918
Institutional Source Beutler Lab
Gene Symbol Olfr849
Ensembl Gene ENSMUSG00000052182
Gene Nameolfactory receptor 849
SynonymsMOR151-1, GA_x6K02T2PVTD-13176842-13177780
MMRRC Submission 040402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R2444 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19440266-19446923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19441015 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 34 (I34K)
Ref Sequence ENSEMBL: ENSMUSP00000149769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063923] [ENSMUST00000217273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063923
AA Change: I34K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064123
Gene: ENSMUSG00000052182
AA Change: I34K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 2.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157237
Predicted Effect possibly damaging
Transcript: ENSMUST00000217273
AA Change: I34K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,068,727 D112E possibly damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abca15 A G 7: 120,365,897 Y794C probably damaging Het
Bicd2 T C 13: 49,379,024 V362A probably benign Het
Cep126 G A 9: 8,101,306 T409M probably damaging Het
Cep131 A G 11: 120,070,495 F610S probably damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Chd1l A G 3: 97,590,566 Y320H probably damaging Het
Dnajc30 A G 5: 135,064,585 D112G probably damaging Het
Fam184a A C 10: 53,640,949 L410R probably damaging Het
Fat2 T C 11: 55,281,973 N2638S probably damaging Het
Fgf15 A G 7: 144,899,692 D134G probably benign Het
Flywch2 A T 17: 23,777,050 S124R possibly damaging Het
Gabra5 G A 7: 57,408,875 T375I probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hltf T A 3: 20,063,907 N44K possibly damaging Het
Kcnb2 A T 1: 15,709,567 N221I probably benign Het
Marco G A 1: 120,494,770 T61M probably damaging Het
Med13 A G 11: 86,331,960 I180T probably damaging Het
Mei1 C T 15: 82,112,941 T626M probably damaging Het
Mtnr1a C T 8: 45,087,658 Q219* probably null Het
Nav3 A G 10: 109,764,915 S1284P probably benign Het
Olfr338 T C 2: 36,377,613 V279A possibly damaging Het
Pcdh9 T A 14: 93,886,791 T648S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Rec114 G T 9: 58,660,319 A128E probably damaging Het
Rspry1 G T 8: 94,623,107 G41V probably damaging Het
Sbf2 A T 7: 110,330,698 M1388K probably benign Het
Spice1 C T 16: 44,366,568 Q143* probably null Het
Tcstv3 A T 13: 120,317,829 K88M probably damaging Het
Terb2 T A 2: 122,193,307 probably null Het
Tmx3 A T 18: 90,540,183 K453M probably damaging Het
Tnc T C 4: 64,014,963 Y688C probably damaging Het
Tshz2 T G 2: 169,884,806 S441A probably benign Het
Usp45 A T 4: 21,817,528 M399L probably benign Het
Vmn2r82 A T 10: 79,377,868 H96L possibly damaging Het
Wdr60 T C 12: 116,232,669 D486G possibly damaging Het
Wls G A 3: 159,907,230 R261Q probably damaging Het
Other mutations in Olfr849
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr849 APN 9 19440970 missense probably benign 0.01
IGL01599:Olfr849 APN 9 19441815 missense probably benign 0.00
IGL01885:Olfr849 APN 9 19441464 missense probably benign 0.01
IGL02258:Olfr849 APN 9 19440997 missense possibly damaging 0.66
IGL02258:Olfr849 APN 9 19440999 missense probably benign 0.00
IGL02282:Olfr849 APN 9 19441618 missense probably benign 0.42
R1293:Olfr849 UTSW 9 19441432 missense probably benign 0.27
R1931:Olfr849 UTSW 9 19441351 missense possibly damaging 0.93
R4181:Olfr849 UTSW 9 19441735 missense possibly damaging 0.86
R4231:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4233:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4236:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4302:Olfr849 UTSW 9 19440999 missense probably benign 0.00
R4651:Olfr849 UTSW 9 19441295 nonsense probably null
R5006:Olfr849 UTSW 9 19441249 missense probably benign 0.30
R5088:Olfr849 UTSW 9 19441771 missense probably damaging 1.00
R5501:Olfr849 UTSW 9 19440994 missense possibly damaging 0.93
R6775:Olfr849 UTSW 9 19441422 missense possibly damaging 0.56
R7038:Olfr849 UTSW 9 19441592 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCCTGTCAAACAAAACAGTGTTTC -3'
(R):5'- TGTGATGGTGTGATCCTCCC -3'

Sequencing Primer
(F):5'- CCATGATGTTTACTATGAAACCTTGC -3'
(R):5'- ATGGTGTGATCCTCCCTCTGAATG -3'
Posted On2014-11-12