Incidental Mutation 'R2444:4833427G06Rik'
List |< first << previous [record 50 of 9592] next >> last >|
ID249919
Institutional Source Beutler Lab
Gene Symbol 4833427G06Rik
Ensembl Gene ENSMUSG00000032057
Gene NameRIKEN cDNA 4833427G06 gene
Synonyms
MMRRC Submission 040402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2444 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location51081115-51102078 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 51099998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126725 (fasta)
Gene Model
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083653
Predicted Effect probably null
Transcript: ENSMUST00000170947
Predicted Effect probably benign
Transcript: ENSMUST00000214452
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,068,727 D112E possibly damaging Het
Abca15 A G 7: 120,365,897 Y794C probably damaging Het
Bicd2 T C 13: 49,379,024 V362A probably benign Het
Cep126 G A 9: 8,101,306 T409M probably damaging Het
Cep131 A G 11: 120,070,495 F610S probably damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Chd1l A G 3: 97,590,566 Y320H probably damaging Het
Dnajc30 A G 5: 135,064,585 D112G probably damaging Het
Fam184a A C 10: 53,640,949 L410R probably damaging Het
Fat2 T C 11: 55,281,973 N2638S probably damaging Het
Fgf15 A G 7: 144,899,692 D134G probably benign Het
Flywch2 A T 17: 23,777,050 S124R possibly damaging Het
Gabra5 G A 7: 57,408,875 T375I probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hltf T A 3: 20,063,907 N44K possibly damaging Het
Kcnb2 A T 1: 15,709,567 N221I probably benign Het
Marco G A 1: 120,494,770 T61M probably damaging Het
Med13 A G 11: 86,331,960 I180T probably damaging Het
Mei1 C T 15: 82,112,941 T626M probably damaging Het
Mtnr1a C T 8: 45,087,658 Q219* probably null Het
Nav3 A G 10: 109,764,915 S1284P probably benign Het
Olfr338 T C 2: 36,377,613 V279A possibly damaging Het
Olfr849 T A 9: 19,441,015 I34K possibly damaging Het
Pcdh9 T A 14: 93,886,791 T648S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Rec114 G T 9: 58,660,319 A128E probably damaging Het
Rspry1 G T 8: 94,623,107 G41V probably damaging Het
Sbf2 A T 7: 110,330,698 M1388K probably benign Het
Spice1 C T 16: 44,366,568 Q143* probably null Het
Tcstv3 A T 13: 120,317,829 K88M probably damaging Het
Terb2 T A 2: 122,193,307 probably null Het
Tmx3 A T 18: 90,540,183 K453M probably damaging Het
Tnc T C 4: 64,014,963 Y688C probably damaging Het
Tshz2 T G 2: 169,884,806 S441A probably benign Het
Usp45 A T 4: 21,817,528 M399L probably benign Het
Vmn2r82 A T 10: 79,377,868 H96L possibly damaging Het
Wdr60 T C 12: 116,232,669 D486G possibly damaging Het
Wls G A 3: 159,907,230 R261Q probably damaging Het
Other mutations in 4833427G06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:4833427G06Rik APN 9 51083586 nonsense probably null
IGL01475:4833427G06Rik APN 9 51100058 missense probably benign 0.28
IGL02137:4833427G06Rik APN 9 51086108 intron probably benign
R0080:4833427G06Rik UTSW 9 51101802 missense probably benign 0.32
R0082:4833427G06Rik UTSW 9 51101802 missense probably benign 0.32
R0631:4833427G06Rik UTSW 9 51101953 missense probably benign 0.00
R1655:4833427G06Rik UTSW 9 51083621 missense probably damaging 0.98
R2116:4833427G06Rik UTSW 9 51101084 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTGGCTGGGAATAAAATCTGTGC -3'
(R):5'- GACAGTATGTATTTGTGTCCCTTCC -3'

Sequencing Primer
(F):5'- AAATCTGTGCTACTAGCCTGAC -3'
(R):5'- GTATGTATTTGTGTCCCTTCCTACTC -3'
Posted On2014-11-12