Incidental Mutation 'R2410:Mrps17'
ID249946
Institutional Source Beutler Lab
Gene Symbol Mrps17
Ensembl Gene ENSMUSG00000034211
Gene Namemitochondrial ribosomal protein S17
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129715497-129722556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129717983 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 64 (V64A)
Ref Sequence ENSEMBL: ENSMUSP00000115189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042191] [ENSMUST00000118420] [ENSMUST00000119576] [ENSMUST00000119604] [ENSMUST00000119985] [ENSMUST00000121339] [ENSMUST00000121813] [ENSMUST00000136108] [ENSMUST00000138812] [ENSMUST00000154358]
Predicted Effect probably damaging
Transcript: ENSMUST00000042191
AA Change: V64A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040281
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118420
AA Change: V64A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112993
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119576
AA Change: V64A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112779
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 83 1.1e-17 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119604
AA Change: V64A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114012
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119985
AA Change: V64A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112762
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121339
AA Change: V64A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114125
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121813
AA Change: V64A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114059
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136108
AA Change: V64A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122093
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138812
Predicted Effect probably damaging
Transcript: ENSMUST00000154358
AA Change: V64A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115189
Gene: ENSMUSG00000034211
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 75 5.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199999
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S17P family. The encoded protein is moderately conserved between human mitochondrial and prokaryotic ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 1p, 3p, 6q, 14p, 18q, and Xq. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Fzd2 A G 11: 102,605,627 Y299C possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Lrrc39 C T 3: 116,581,250 P327S probably benign Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Me2 A T 18: 73,791,112 M343K probably damaging Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rab14 T C 2: 35,186,750 probably null Het
Rnf43 T C 11: 87,732,259 Y729H possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Tmem255b A G 8: 13,441,278 I66V probably benign Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Zfp954 A T 7: 7,117,809 I74N probably benign Het
Other mutations in Mrps17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Mrps17 APN 5 129716765 missense probably benign 0.01
IGL01904:Mrps17 APN 5 129716801 missense probably damaging 1.00
IGL02137:Mrps17 APN 5 129716783 missense probably benign 0.16
IGL02139:Mrps17 APN 5 129716796 missense probably damaging 0.97
IGL03266:Mrps17 APN 5 129716742 utr 5 prime probably benign
R0350:Mrps17 UTSW 5 129718145 unclassified probably benign
R7329:Mrps17 UTSW 5 129716641 intron probably benign
R7337:Mrps17 UTSW 5 129716799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACTAGAGTGACAGCAGTG -3'
(R):5'- TGGGTTCAGGAGACCTTGAG -3'

Sequencing Primer
(F):5'- GCAGCTTCCCGGAGTTG -3'
(R):5'- GTTCAGGAGACCTTGAGCTCCTC -3'
Posted On2014-11-12