Incidental Mutation 'R2410:Zfp954'
ID249949
Institutional Source Beutler Lab
Gene Symbol Zfp954
Ensembl Gene ENSMUSG00000062116
Gene Namezinc finger protein 954
Synonyms5730403M16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location7114690-7121488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7117809 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 74 (I74N)
Ref Sequence ENSEMBL: ENSMUSP00000072585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056246]
Predicted Effect probably benign
Transcript: ENSMUST00000056246
AA Change: I74N

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072585
Gene: ENSMUSG00000062116
AA Change: I74N

DomainStartEndE-ValueType
KRAB 42 102 4.6e-14 SMART
ZnF_C2H2 198 220 5.14e-3 SMART
ZnF_C2H2 226 248 3.21e-4 SMART
ZnF_C2H2 254 276 3.63e-3 SMART
ZnF_C2H2 282 304 7.9e-4 SMART
ZnF_C2H2 310 332 1.69e-3 SMART
ZnF_C2H2 338 360 1.26e-2 SMART
ZnF_C2H2 364 386 2.01e-5 SMART
ZnF_C2H2 392 414 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210142
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Fzd2 A G 11: 102,605,627 Y299C possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Lrrc39 C T 3: 116,581,250 P327S probably benign Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Me2 A T 18: 73,791,112 M343K probably damaging Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Mrps17 T C 5: 129,717,983 V64A probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rab14 T C 2: 35,186,750 probably null Het
Rnf43 T C 11: 87,732,259 Y729H possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Tmem255b A G 8: 13,441,278 I66V probably benign Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Other mutations in Zfp954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Zfp954 APN 7 7115367 missense probably benign 0.01
IGL01696:Zfp954 APN 7 7115398 missense probably damaging 1.00
R0196:Zfp954 UTSW 7 7115391 missense probably damaging 1.00
R1723:Zfp954 UTSW 7 7115838 missense probably benign 0.04
R2112:Zfp954 UTSW 7 7115610 missense probably damaging 1.00
R2255:Zfp954 UTSW 7 7115322 missense possibly damaging 0.84
R5118:Zfp954 UTSW 7 7115715 missense probably benign 0.05
R5191:Zfp954 UTSW 7 7116023 missense probably damaging 0.96
R5832:Zfp954 UTSW 7 7115390 missense probably damaging 0.97
R5851:Zfp954 UTSW 7 7115625 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAAAGGTAGTTGTGTAACAAGCC -3'
(R):5'- ATAGGTTCACAGCCTGGTACC -3'

Sequencing Primer
(F):5'- AGGTAGTTGTGTAACAAGCCTATGTC -3'
(R):5'- TACCCTCTGAGATAGGAGCCTAAG -3'
Posted On2014-11-12