Incidental Mutation 'R2410:Rnf43'
ID249956
Institutional Source Beutler Lab
Gene Symbol Rnf43
Ensembl Gene ENSMUSG00000034177
Gene Namering finger protein 43
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87662722-87735539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87732259 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 729 (Y729H)
Ref Sequence ENSEMBL: ENSMUSP00000130685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040089] [ENSMUST00000092800] [ENSMUST00000121782] [ENSMUST00000165679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040089
AA Change: Y602H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044241
Gene: ENSMUSG00000034177
AA Change: Y602H

DomainStartEndE-ValueType
PDB:4KNG|F 1 71 7e-32 PDB
transmembrane domain 72 91 N/A INTRINSIC
RING 145 185 6.43e-8 SMART
low complexity region 337 351 N/A INTRINSIC
low complexity region 366 376 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
low complexity region 646 654 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092800
AA Change: Y729H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090476
Gene: ENSMUSG00000034177
AA Change: Y729H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121782
AA Change: Y688H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112748
Gene: ENSMUSG00000034177
AA Change: Y688H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 157 6e-54 PDB
transmembrane domain 158 177 N/A INTRINSIC
RING 231 271 6.43e-8 SMART
low complexity region 423 437 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 577 602 N/A INTRINSIC
low complexity region 732 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162740
Predicted Effect possibly damaging
Transcript: ENSMUST00000165679
AA Change: Y729H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130685
Gene: ENSMUSG00000034177
AA Change: Y729H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RING-type E3 ubiquitin ligase and is predicted to contain a transmembrane domain, a protease-associated domain, an ectodomain, and a cytoplasmic RING domain. This protein is thought to negatively regulate Wnt signaling, and expression of this gene results in an increase in ubiquitination of frizzled receptors, an alteration in their subcellular distribution, resulting in reduced surface levels of these receptors. Mutations in this gene have been reported in multiple tumor cells, including colorectal and endometrial cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Fzd2 A G 11: 102,605,627 Y299C possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Lrrc39 C T 3: 116,581,250 P327S probably benign Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Me2 A T 18: 73,791,112 M343K probably damaging Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Mrps17 T C 5: 129,717,983 V64A probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rab14 T C 2: 35,186,750 probably null Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Tmem255b A G 8: 13,441,278 I66V probably benign Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Zfp954 A T 7: 7,117,809 I74N probably benign Het
Other mutations in Rnf43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Rnf43 APN 11 87731892 missense probably benign 0.15
IGL01520:Rnf43 APN 11 87664716 missense probably damaging 1.00
IGL01541:Rnf43 APN 11 87730220 missense probably null 1.00
IGL01784:Rnf43 APN 11 87731806 missense possibly damaging 0.56
IGL02037:Rnf43 APN 11 87731653 missense probably benign 0.00
IGL02725:Rnf43 APN 11 87731585 missense probably damaging 1.00
IGL03062:Rnf43 APN 11 87732304 nonsense probably null
R0226:Rnf43 UTSW 11 87731437 missense probably damaging 1.00
R0391:Rnf43 UTSW 11 87731282 missense possibly damaging 0.86
R0834:Rnf43 UTSW 11 87731251 missense probably benign
R1163:Rnf43 UTSW 11 87729513 missense probably damaging 0.98
R1203:Rnf43 UTSW 11 87727475 splice site probably benign
R1314:Rnf43 UTSW 11 87732319 missense probably benign
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1511:Rnf43 UTSW 11 87731347 missense probably benign 0.00
R1513:Rnf43 UTSW 11 87729431 missense probably damaging 1.00
R1614:Rnf43 UTSW 11 87731659 nonsense probably null
R1615:Rnf43 UTSW 11 87731659 nonsense probably null
R2341:Rnf43 UTSW 11 87732025 missense probably damaging 0.96
R2847:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R2849:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R5567:Rnf43 UTSW 11 87727445 missense probably damaging 1.00
R5943:Rnf43 UTSW 11 87731735 missense probably damaging 1.00
R6135:Rnf43 UTSW 11 87732125 missense probably damaging 1.00
R6452:Rnf43 UTSW 11 87732253 missense probably damaging 1.00
R6511:Rnf43 UTSW 11 87732163 missense probably benign 0.01
X0064:Rnf43 UTSW 11 87727342 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATCCAGCCTCACTGTCAGAC -3'
(R):5'- GAGTCTCCTCTTCCCAGAACAC -3'

Sequencing Primer
(F):5'- TGGTCCCTCAGAACCCCTG -3'
(R):5'- CAGAACACCTGCTTCCCTG -3'
Posted On2014-11-12