Incidental Mutation 'R2410:1700012B07Rik'
List |< first << previous [record 36 of 18188] next >> last >|
ID249958
Institutional Source Beutler Lab
Gene Symbol 1700012B07Rik
Ensembl Gene ENSMUSG00000020617
Gene NameRIKEN cDNA 1700012B07 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location109787651-109828046 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 109794154 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 172 (C172*)
Ref Sequence ENSEMBL: ENSMUSP00000102285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020941] [ENSMUST00000106674] [ENSMUST00000143578]
Predicted Effect probably null
Transcript: ENSMUST00000020941
AA Change: C172*
SMART Domains Protein: ENSMUSP00000020941
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106674
AA Change: C172*
SMART Domains Protein: ENSMUSP00000102285
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143578
SMART Domains Protein: ENSMUSP00000115395
Gene: ENSMUSG00000020617

DomainStartEndE-ValueType
low complexity region 33 38 N/A INTRINSIC
low complexity region 53 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147006
Meta Mutation Damage Score 0.6404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Fzd2 A G 11: 102,605,627 Y299C possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Lrrc39 C T 3: 116,581,250 P327S probably benign Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Me2 A T 18: 73,791,112 M343K probably damaging Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Mrps17 T C 5: 129,717,983 V64A probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rab14 T C 2: 35,186,750 probably null Het
Rnf43 T C 11: 87,732,259 Y729H possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Tmem255b A G 8: 13,441,278 I66V probably benign Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Zfp954 A T 7: 7,117,809 I74N probably benign Het
Other mutations in 1700012B07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:1700012B07Rik APN 11 109794111 missense probably damaging 0.99
IGL03006:1700012B07Rik APN 11 109827845 missense probably damaging 0.98
R0626:1700012B07Rik UTSW 11 109788721 unclassified probably benign
R1566:1700012B07Rik UTSW 11 109788806 missense probably benign 0.01
R1654:1700012B07Rik UTSW 11 109797399 missense probably benign 0.36
R2373:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2405:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2411:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3707:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3708:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3732:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3745:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3783:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3784:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3785:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3805:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3806:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3922:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3926:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4085:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4089:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4110:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4111:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4112:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4171:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4506:1700012B07Rik UTSW 11 109794261 missense probably damaging 1.00
R4825:1700012B07Rik UTSW 11 109791672 missense probably benign 0.00
R5032:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5033:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5971:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6078:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6079:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6138:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6354:1700012B07Rik UTSW 11 109794216 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCCTCTGTAGATAATGAGTCCGG -3'
(R):5'- ACAGCTTGTCTAACGAAGCAC -3'

Sequencing Primer
(F):5'- TCCGGAGAATAGATGCTTGCCAATC -3'
(R):5'- GCTTGTCTAACGAAGCACCCATG -3'
Posted On2014-11-12