Incidental Mutation 'R2410:Me2'
ID249965
Institutional Source Beutler Lab
Gene Symbol Me2
Ensembl Gene ENSMUSG00000024556
Gene Namemalic enzyme 2, NAD(+)-dependent, mitochondrial
SynonymsD030040L20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location73770040-73815392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73791112 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 343 (M343K)
Ref Sequence ENSEMBL: ENSMUSP00000025439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025439]
Predicted Effect probably damaging
Transcript: ENSMUST00000025439
AA Change: M343K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025439
Gene: ENSMUSG00000024556
AA Change: M343K

DomainStartEndE-ValueType
malic 89 270 3.48e-98 SMART
Malic_M 280 535 2.21e-103 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial NAD-dependent malic enzyme, a homotetrameric protein, that catalyzes the oxidative decarboxylation of malate to pyruvate. It had previously been weakly linked to a syndrome known as Friedreich ataxia that has since been shown to be the result of mutation in a completely different gene. Certain single-nucleotide polymorphism haplotypes of this gene have been shown to increase the risk for idiopathic generalized epilepsy. Alternatively spliced transcript variants encoding different isoforms found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Fzd2 A G 11: 102,605,627 Y299C possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Lrrc39 C T 3: 116,581,250 P327S probably benign Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Mrps17 T C 5: 129,717,983 V64A probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rab14 T C 2: 35,186,750 probably null Het
Rnf43 T C 11: 87,732,259 Y729H possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Tmem255b A G 8: 13,441,278 I66V probably benign Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Zfp954 A T 7: 7,117,809 I74N probably benign Het
Other mutations in Me2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Me2 APN 18 73770642 missense probably benign 0.01
IGL00977:Me2 APN 18 73791177 missense probably benign 0.24
IGL01161:Me2 APN 18 73770816 splice site probably benign
IGL02351:Me2 APN 18 73797967 missense probably benign 0.20
IGL02358:Me2 APN 18 73797967 missense probably benign 0.20
IGL02647:Me2 APN 18 73797903 missense probably benign 0.00
IGL03172:Me2 APN 18 73770726 missense probably benign
baako UTSW 18 73797945 missense probably damaging 1.00
first_born UTSW 18 73791128 nonsense probably null
muster UTSW 18 73791844 missense probably benign 0.01
Roundup UTSW 18 73770673 missense probably benign
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0032:Me2 UTSW 18 73794525 missense probably benign
R0119:Me2 UTSW 18 73770673 missense probably benign
R0136:Me2 UTSW 18 73770673 missense probably benign
R0299:Me2 UTSW 18 73770673 missense probably benign
R0657:Me2 UTSW 18 73770673 missense probably benign
R1597:Me2 UTSW 18 73797945 missense probably damaging 1.00
R1638:Me2 UTSW 18 73773134 missense probably benign 0.03
R1765:Me2 UTSW 18 73791858 missense probably damaging 1.00
R1861:Me2 UTSW 18 73785714 missense probably benign 0.11
R3422:Me2 UTSW 18 73791194 missense probably damaging 0.99
R3954:Me2 UTSW 18 73781132 missense probably damaging 1.00
R3957:Me2 UTSW 18 73781132 missense probably damaging 1.00
R4052:Me2 UTSW 18 73791085 missense probably benign 0.05
R4207:Me2 UTSW 18 73791085 missense probably benign 0.05
R4208:Me2 UTSW 18 73791085 missense probably benign 0.05
R4694:Me2 UTSW 18 73801859 missense probably benign 0.01
R4962:Me2 UTSW 18 73785776 missense probably damaging 1.00
R5527:Me2 UTSW 18 73791116 missense probably damaging 1.00
R6170:Me2 UTSW 18 73785781 missense probably benign 0.07
R6185:Me2 UTSW 18 73791128 nonsense probably null
R6305:Me2 UTSW 18 73791844 missense probably benign 0.01
R6462:Me2 UTSW 18 73775399 missense probably benign 0.17
R7085:Me2 UTSW 18 73781058 missense probably damaging 1.00
R7096:Me2 UTSW 18 73794890 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGGCTTAGATGGACAGCCTGC -3'
(R):5'- GAGACTGACAAAGAATCTACTTACG -3'

Sequencing Primer
(F):5'- GGTTAGGGTCATTTTATCACAGCCAC -3'
(R):5'- ATATGGGCGTTCCCTCAT -3'
Posted On2014-11-12