Incidental Mutation 'R2411:Mtmr10'
ID249988
Institutional Source Beutler Lab
Gene Symbol Mtmr10
Ensembl Gene ENSMUSG00000030522
Gene Namemyotubularin related protein 10
Synonyms
MMRRC Submission 040376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R2411 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64287653-64340806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64297497 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 53 (K53N)
Ref Sequence ENSEMBL: ENSMUSP00000146259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032736] [ENSMUST00000206452]
Predicted Effect probably benign
Transcript: ENSMUST00000032736
AA Change: K53N

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032736
Gene: ENSMUSG00000030522
AA Change: K53N

DomainStartEndE-ValueType
Pfam:Myotub-related 176 330 8.6e-12 PFAM
Pfam:Myotub-related 319 508 2.7e-56 PFAM
Pfam:3-PAP 570 701 2.2e-57 PFAM
low complexity region 730 737 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173123
AA Change: K96N
Predicted Effect probably damaging
Transcript: ENSMUST00000174210
AA Change: K53N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206452
AA Change: K53N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206732
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4933402D24Rik A G 1: 63,756,214 probably benign Het
9030612E09Rik G T 10: 43,174,800 R30L possibly damaging Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Aadacl2 A G 3: 60,017,423 D137G possibly damaging Het
Acad11 T G 9: 104,086,023 probably benign Het
Acap1 A T 11: 69,885,485 N229K probably damaging Het
Agbl1 A G 7: 76,720,150 T666A probably damaging Het
Btbd16 T C 7: 130,790,224 F160L probably damaging Het
Clock A C 5: 76,231,513 H525Q probably benign Het
Col6a1 G T 10: 76,711,088 Q767K unknown Het
Creld1 A G 6: 113,489,776 H240R probably benign Het
Dlg4 G A 11: 70,041,929 probably null Het
Fam204a A T 19: 60,199,438 *237R probably null Het
Filip1 T A 9: 79,898,433 N13I probably damaging Het
Gm14295 G T 2: 176,807,413 A19S probably benign Het
Hddc3 A T 7: 80,343,593 Q56L probably damaging Het
Hes6 A C 1: 91,413,264 probably null Het
Hormad1 A G 3: 95,580,015 D270G probably benign Het
Ifitm1 A G 7: 140,969,798 probably null Het
Igbp1b A C 6: 138,657,873 V191G probably damaging Het
Impg2 T A 16: 56,252,154 N316K probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lilra6 T C 7: 3,911,454 Y566C probably damaging Het
Map4k4 A G 1: 40,007,496 D775G probably damaging Het
Mybpc2 G A 7: 44,506,238 R864W probably damaging Het
Nckap1l C A 15: 103,483,568 P810Q probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1197 C T 2: 88,729,397 M67I probably benign Het
Olfr1377 A G 11: 50,984,931 T77A probably damaging Het
Olfr301 T C 7: 86,413,082 V281A possibly damaging Het
Ppp2r3c T C 12: 55,298,484 K73R probably benign Het
Ptpru A T 4: 131,771,469 F1311Y probably damaging Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Setd2 A G 9: 110,550,429 E1104G possibly damaging Het
St14 G A 9: 31,108,234 T97I probably benign Het
Stag3 A G 5: 138,283,028 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tor1b G T 2: 30,955,812 S167I probably damaging Het
Ttn T A 2: 76,738,015 E27511D probably damaging Het
Uso1 T A 5: 92,158,399 probably benign Het
Vmn1r10 G T 6: 57,114,139 V239F probably benign Het
Zfp160 C T 17: 21,025,745 R186C possibly damaging Het
Zfp869 A G 8: 69,706,529 C465R probably damaging Het
Zfp957 T C 14: 79,214,342 K6E unknown Het
Other mutations in Mtmr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Mtmr10 APN 7 64337712 missense probably benign
IGL02082:Mtmr10 APN 7 64333490 splice site probably benign
IGL02234:Mtmr10 APN 7 64299602 missense probably benign 0.04
IGL02448:Mtmr10 APN 7 64308150 missense probably damaging 1.00
IGL02515:Mtmr10 APN 7 64337511 missense probably damaging 1.00
Curlyq UTSW 7 64333439 missense probably damaging 1.00
K7371:Mtmr10 UTSW 7 64314210 missense probably benign 0.18
PIT4472001:Mtmr10 UTSW 7 64333358 missense probably benign 0.23
R0302:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R0619:Mtmr10 UTSW 7 64321213 missense probably benign 0.00
R0787:Mtmr10 UTSW 7 64300615 missense possibly damaging 0.95
R0972:Mtmr10 UTSW 7 64326709 missense probably damaging 1.00
R1482:Mtmr10 UTSW 7 64314249 missense probably damaging 1.00
R1770:Mtmr10 UTSW 7 64336721 missense possibly damaging 0.47
R1826:Mtmr10 UTSW 7 64337466 missense probably benign 0.00
R2174:Mtmr10 UTSW 7 64336764 missense possibly damaging 0.94
R2215:Mtmr10 UTSW 7 64337655 missense probably benign 0.00
R2352:Mtmr10 UTSW 7 64297580 missense possibly damaging 0.71
R3702:Mtmr10 UTSW 7 64337899 missense probably damaging 1.00
R3710:Mtmr10 UTSW 7 64326685 missense possibly damaging 0.86
R3802:Mtmr10 UTSW 7 64320628 missense probably benign 0.29
R4190:Mtmr10 UTSW 7 64314186 missense probably benign 0.37
R4484:Mtmr10 UTSW 7 64320631 missense possibly damaging 0.86
R4562:Mtmr10 UTSW 7 64314159 missense possibly damaging 0.92
R5128:Mtmr10 UTSW 7 64333439 missense probably damaging 1.00
R5203:Mtmr10 UTSW 7 64318161 missense probably benign
R5444:Mtmr10 UTSW 7 64288401 unclassified probably null
R5627:Mtmr10 UTSW 7 64336752 missense probably damaging 1.00
R5786:Mtmr10 UTSW 7 64337710 missense probably damaging 1.00
R7078:Mtmr10 UTSW 7 64320627 missense possibly damaging 0.65
R7236:Mtmr10 UTSW 7 64314184 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- ATGGCAGCTCTTCTTCACAG -3'
(R):5'- CCACCGTTTACAGTGTATTTCTAG -3'

Sequencing Primer
(F):5'- ACAGTCATTCTTTCAGCCACCAG -3'
(R):5'- GTGTATTTCTAGCAGTAATGCATTGC -3'
Posted On2014-11-12