Incidental Mutation 'R2411:Acad11'
ID249996
Institutional Source Beutler Lab
Gene Symbol Acad11
Ensembl Gene ENSMUSG00000090150
Gene Nameacyl-Coenzyme A dehydrogenase family, member 11
Synonyms5730439E10Rik
MMRRC Submission 040376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R2411 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104063377-104127725 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 104086023 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047799] [ENSMUST00000120854] [ENSMUST00000189998]
Predicted Effect probably benign
Transcript: ENSMUST00000047799
SMART Domains Protein: ENSMUSP00000043424
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 43 307 3.5e-45 PFAM
Pfam:Acyl-CoA_dh_N 376 498 1.5e-13 PFAM
Pfam:Acyl-CoA_dh_M 502 605 1.7e-21 PFAM
Pfam:Acyl-CoA_dh_1 617 768 2.7e-36 PFAM
Pfam:Acyl-CoA_dh_2 632 743 2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050139
SMART Domains Protein: ENSMUSP00000062941
Gene: ENSMUSG00000041748

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120854
SMART Domains Protein: ENSMUSP00000112994
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 1 188 1.1e-28 PFAM
Pfam:EcKinase 49 143 4.8e-9 PFAM
Pfam:Acyl-CoA_dh_N 257 380 8.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 385 439 2.4e-19 PFAM
Pfam:Acyl-CoA_dh_1 499 650 1.3e-37 PFAM
Pfam:Acyl-CoA_dh_2 514 632 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189998
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an acyl-CoA dehydrogenase enzyme with a preference for carbon chain lengths between 20 and 26. Naturally occurring read-through transcription occurs between the upstream gene NPHP3 (nephronophthisis 3 (adolescent)) and this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4933402D24Rik A G 1: 63,756,214 probably benign Het
9030612E09Rik G T 10: 43,174,800 R30L possibly damaging Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Aadacl2 A G 3: 60,017,423 D137G possibly damaging Het
Acap1 A T 11: 69,885,485 N229K probably damaging Het
Agbl1 A G 7: 76,720,150 T666A probably damaging Het
Btbd16 T C 7: 130,790,224 F160L probably damaging Het
Clock A C 5: 76,231,513 H525Q probably benign Het
Col6a1 G T 10: 76,711,088 Q767K unknown Het
Creld1 A G 6: 113,489,776 H240R probably benign Het
Dlg4 G A 11: 70,041,929 probably null Het
Fam204a A T 19: 60,199,438 *237R probably null Het
Filip1 T A 9: 79,898,433 N13I probably damaging Het
Gm14295 G T 2: 176,807,413 A19S probably benign Het
Hddc3 A T 7: 80,343,593 Q56L probably damaging Het
Hes6 A C 1: 91,413,264 probably null Het
Hormad1 A G 3: 95,580,015 D270G probably benign Het
Ifitm1 A G 7: 140,969,798 probably null Het
Igbp1b A C 6: 138,657,873 V191G probably damaging Het
Impg2 T A 16: 56,252,154 N316K probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lilra6 T C 7: 3,911,454 Y566C probably damaging Het
Map4k4 A G 1: 40,007,496 D775G probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Mybpc2 G A 7: 44,506,238 R864W probably damaging Het
Nckap1l C A 15: 103,483,568 P810Q probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1197 C T 2: 88,729,397 M67I probably benign Het
Olfr1377 A G 11: 50,984,931 T77A probably damaging Het
Olfr301 T C 7: 86,413,082 V281A possibly damaging Het
Ppp2r3c T C 12: 55,298,484 K73R probably benign Het
Ptpru A T 4: 131,771,469 F1311Y probably damaging Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Setd2 A G 9: 110,550,429 E1104G possibly damaging Het
St14 G A 9: 31,108,234 T97I probably benign Het
Stag3 A G 5: 138,283,028 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tor1b G T 2: 30,955,812 S167I probably damaging Het
Ttn T A 2: 76,738,015 E27511D probably damaging Het
Uso1 T A 5: 92,158,399 probably benign Het
Vmn1r10 G T 6: 57,114,139 V239F probably benign Het
Zfp160 C T 17: 21,025,745 R186C possibly damaging Het
Zfp869 A G 8: 69,706,529 C465R probably damaging Het
Zfp957 T C 14: 79,214,342 K6E unknown Het
Other mutations in Acad11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Acad11 APN 9 104126656 missense probably damaging 1.00
IGL01100:Acad11 APN 9 104076408 missense probably damaging 0.98
IGL01920:Acad11 APN 9 104063905 critical splice donor site probably null
IGL02019:Acad11 APN 9 104115345 missense probably damaging 1.00
IGL02506:Acad11 APN 9 104091732 critical splice donor site probably null
IGL02742:Acad11 APN 9 104095625 missense probably damaging 1.00
IGL02830:Acad11 APN 9 104075919 missense probably damaging 1.00
IGL02936:Acad11 APN 9 104113512 missense probably benign 0.31
R0092:Acad11 UTSW 9 104090341 splice site probably benign
R0277:Acad11 UTSW 9 104124025 missense probably damaging 1.00
R0377:Acad11 UTSW 9 104081692 splice site probably benign
R0411:Acad11 UTSW 9 104116296 missense probably damaging 1.00
R0556:Acad11 UTSW 9 104115302 missense probably damaging 1.00
R0594:Acad11 UTSW 9 104095563 missense probably benign 0.09
R0688:Acad11 UTSW 9 104124100 missense probably damaging 1.00
R1416:Acad11 UTSW 9 104073623 missense probably damaging 0.96
R1551:Acad11 UTSW 9 104126586 missense probably damaging 0.99
R1730:Acad11 UTSW 9 104063882 missense probably benign 0.02
R1819:Acad11 UTSW 9 104114539 critical splice donor site probably null
R1884:Acad11 UTSW 9 104114485 missense probably benign 0.13
R3055:Acad11 UTSW 9 104076336 missense probably damaging 0.98
R3683:Acad11 UTSW 9 104115344 missense probably damaging 1.00
R3954:Acad11 UTSW 9 104086152 intron probably benign
R3956:Acad11 UTSW 9 104086152 intron probably benign
R4425:Acad11 UTSW 9 104073645 missense probably damaging 1.00
R4557:Acad11 UTSW 9 104082839 missense probably benign 0.00
R4701:Acad11 UTSW 9 104095565 nonsense probably null
R4764:Acad11 UTSW 9 104075877 missense probably damaging 0.99
R4872:Acad11 UTSW 9 104086266 intron probably benign
R5132:Acad11 UTSW 9 104126592 missense probably benign 0.03
R5161:Acad11 UTSW 9 104124028 missense probably benign 0.19
R5222:Acad11 UTSW 9 104097377 missense probably damaging 1.00
R5587:Acad11 UTSW 9 104063767 missense probably benign
R5683:Acad11 UTSW 9 104084283 missense probably damaging 1.00
R6512:Acad11 UTSW 9 104095559 nonsense probably null
R6815:Acad11 UTSW 9 104081327 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCCAGCTCACCTTATCAG -3'
(R):5'- ATGCCATCAATGTGGGAACATAG -3'

Sequencing Primer
(F):5'- GTCCATCTGATTCTTATGAATGCAC -3'
(R):5'- ACACCAAGTGGCTGTCCTTAC -3'
Posted On2014-11-12