Incidental Mutation 'R2414:Polr1b'
ID250087
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
MMRRC Submission 040378-MU
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2414 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 129103134 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000103205]
Predicted Effect probably benign
Transcript: ENSMUST00000028874
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103205
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (38/38)
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 C A 9: 121,908,974 S138R probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arfgef2 A G 2: 166,845,504 E216G probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
AU040320 A T 4: 126,868,691 probably null Het
BC002059 T C 17: 16,973,670 noncoding transcript Het
Cep112 A G 11: 108,752,582 N799S possibly damaging Het
Cilp A G 9: 65,274,645 probably benign Het
Cpn2 T C 16: 30,260,574 E103G probably benign Het
Cpt1b G A 15: 89,420,080 probably benign Het
Epor T A 9: 21,959,489 D365V probably damaging Het
Hip1r T C 5: 124,001,243 Y900H probably damaging Het
Hist2h2be T A 3: 96,221,434 I90N possibly damaging Het
Hoxc9 A T 15: 102,984,108 N251I probably damaging Het
Hpd C T 5: 123,177,524 probably null Het
Lrrc34 T A 3: 30,634,562 I197L probably benign Het
Msi2 A G 11: 88,716,547 V78A probably damaging Het
Myh4 A G 11: 67,250,768 I818V probably benign Het
Nol4 T C 18: 22,823,572 probably null Het
Plekha5 A G 6: 140,550,856 N362S probably damaging Het
Rc3h2 A T 2: 37,399,819 probably null Het
Sgsm3 A G 15: 81,006,745 N136D probably benign Het
Slco1a5 A G 6: 142,236,250 C583R probably damaging Het
Surf1 A G 2: 26,916,283 W13R probably damaging Het
Tesk2 T C 4: 116,801,757 W276R possibly damaging Het
Tmem8b A G 4: 43,673,892 probably benign Het
Togaram2 T G 17: 71,716,309 probably benign Het
Ttll11 A G 2: 35,979,534 S31P unknown Het
Ttll8 A G 15: 88,936,133 probably benign Het
Tub A G 7: 109,027,033 K259E probably damaging Het
Ube2o T C 11: 116,548,857 I162M probably benign Het
Vamp8 C T 6: 72,388,343 M1I probably null Het
Zfp503 C A 14: 21,985,964 G295* probably null Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGAATTGTCTTTCAGGCCATAC -3'
(R):5'- ATTCACGGCCCAGCTGATATC -3'

Sequencing Primer
(F):5'- GGCCATACCTCCCTTTGAATTTG -3'
(R):5'- ACCAGATGTGTGTCTGAACC -3'
Posted On2014-11-12