Incidental Mutation 'R2414:Hip1r'
ID250098
Institutional Source Beutler Lab
Gene Symbol Hip1r
Ensembl Gene ENSMUSG00000000915
Gene Namehuntingtin interacting protein 1 related
Synonyms
MMRRC Submission 040378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2414 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123973628-124005558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124001243 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 900 (Y900H)
Ref Sequence ENSEMBL: ENSMUSP00000000939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000939] [ENSMUST00000040967]
Predicted Effect probably damaging
Transcript: ENSMUST00000000939
AA Change: Y900H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000939
Gene: ENSMUSG00000000915
AA Change: Y900H

DomainStartEndE-ValueType
ENTH 29 151 5.27e-40 SMART
low complexity region 301 321 N/A INTRINSIC
PDB:3I00|B 340 458 1e-21 PDB
Pfam:HIP1_clath_bdg 461 559 1.1e-34 PFAM
low complexity region 627 633 N/A INTRINSIC
ILWEQ 814 1012 9.19e-121 SMART
low complexity region 1016 1035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040967
SMART Domains Protein: ENSMUSP00000047980
Gene: ENSMUSG00000066278

DomainStartEndE-ValueType
Pfam:Mod_r 11 156 3.9e-40 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166258
SMART Domains Protein: ENSMUSP00000130766
Gene: ENSMUSG00000000915

DomainStartEndE-ValueType
Pfam:ANTH 1 79 3.5e-19 PFAM
low complexity region 80 100 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192309
Predicted Effect probably benign
Transcript: ENSMUST00000198664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199306
Meta Mutation Damage Score 0.0224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 C A 9: 121,908,974 S138R probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arfgef2 A G 2: 166,845,504 E216G probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
AU040320 A T 4: 126,868,691 probably null Het
BC002059 T C 17: 16,973,670 noncoding transcript Het
Cep112 A G 11: 108,752,582 N799S possibly damaging Het
Cilp A G 9: 65,274,645 probably benign Het
Cpn2 T C 16: 30,260,574 E103G probably benign Het
Cpt1b G A 15: 89,420,080 probably benign Het
Epor T A 9: 21,959,489 D365V probably damaging Het
Hist2h2be T A 3: 96,221,434 I90N possibly damaging Het
Hoxc9 A T 15: 102,984,108 N251I probably damaging Het
Hpd C T 5: 123,177,524 probably null Het
Lrrc34 T A 3: 30,634,562 I197L probably benign Het
Msi2 A G 11: 88,716,547 V78A probably damaging Het
Myh4 A G 11: 67,250,768 I818V probably benign Het
Nol4 T C 18: 22,823,572 probably null Het
Plekha5 A G 6: 140,550,856 N362S probably damaging Het
Polr1b A G 2: 129,103,134 probably benign Het
Rc3h2 A T 2: 37,399,819 probably null Het
Sgsm3 A G 15: 81,006,745 N136D probably benign Het
Slco1a5 A G 6: 142,236,250 C583R probably damaging Het
Surf1 A G 2: 26,916,283 W13R probably damaging Het
Tesk2 T C 4: 116,801,757 W276R possibly damaging Het
Tmem8b A G 4: 43,673,892 probably benign Het
Togaram2 T G 17: 71,716,309 probably benign Het
Ttll11 A G 2: 35,979,534 S31P unknown Het
Ttll8 A G 15: 88,936,133 probably benign Het
Tub A G 7: 109,027,033 K259E probably damaging Het
Ube2o T C 11: 116,548,857 I162M probably benign Het
Vamp8 C T 6: 72,388,343 M1I probably null Het
Zfp503 C A 14: 21,985,964 G295* probably null Het
Other mutations in Hip1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hip1r APN 5 123989735 critical splice donor site probably null
IGL01771:Hip1r APN 5 123999543 missense possibly damaging 0.95
IGL01804:Hip1r APN 5 124001550 critical splice donor site probably null
IGL02100:Hip1r APN 5 123998943 unclassified probably benign
IGL02139:Hip1r APN 5 123996244 missense probably damaging 1.00
IGL02321:Hip1r APN 5 123999890 missense probably damaging 0.99
IGL02562:Hip1r APN 5 123991523 unclassified probably benign
IGL02745:Hip1r APN 5 123990939 splice site probably null
IGL02798:Hip1r APN 5 123994712 unclassified probably benign
IGL03365:Hip1r APN 5 124000167 missense probably damaging 1.00
R0172:Hip1r UTSW 5 123996940 missense possibly damaging 0.47
R0546:Hip1r UTSW 5 123999051 missense possibly damaging 0.89
R0799:Hip1r UTSW 5 123996941 missense probably benign 0.00
R1588:Hip1r UTSW 5 123996575 missense probably damaging 0.98
R1590:Hip1r UTSW 5 124002140 missense probably benign 0.00
R1675:Hip1r UTSW 5 123994820 missense probably damaging 1.00
R1801:Hip1r UTSW 5 123998808 missense probably benign
R1818:Hip1r UTSW 5 123995955 critical splice donor site probably null
R1852:Hip1r UTSW 5 123991505 missense probably benign 0.10
R1936:Hip1r UTSW 5 123996071 missense probably damaging 1.00
R1954:Hip1r UTSW 5 124001844 missense probably damaging 0.96
R1989:Hip1r UTSW 5 123989698 missense probably damaging 1.00
R2045:Hip1r UTSW 5 124000731 missense probably benign
R2105:Hip1r UTSW 5 124000204 missense probably damaging 0.96
R2909:Hip1r UTSW 5 124000593 splice site probably null
R3125:Hip1r UTSW 5 124000141 missense probably benign 0.20
R3401:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3402:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3889:Hip1r UTSW 5 124001791 nonsense probably null
R4212:Hip1r UTSW 5 123999890 missense probably benign 0.06
R4421:Hip1r UTSW 5 123997862 missense possibly damaging 0.66
R4422:Hip1r UTSW 5 123997006 missense possibly damaging 0.93
R4713:Hip1r UTSW 5 123989980 missense probably benign 0.02
R6837:Hip1r UTSW 5 123998865 missense possibly damaging 0.63
R7171:Hip1r UTSW 5 123995944 missense probably benign 0.02
R7212:Hip1r UTSW 5 123973782 missense possibly damaging 0.91
R7251:Hip1r UTSW 5 123994750 missense probably damaging 1.00
R7319:Hip1r UTSW 5 123999111 missense probably damaging 1.00
R7432:Hip1r UTSW 5 123991766 missense probably benign 0.05
Z1088:Hip1r UTSW 5 123999132 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTGAAGGCCTCATCTCAGC -3'
(R):5'- TGTTGGCTTTCACCTGCAGG -3'

Sequencing Primer
(F):5'- GAAGGCCTCATCTCAGCCTCTAAG -3'
(R):5'- CAGGGAGCAGAGTGGGCATG -3'
Posted On2014-11-12