Incidental Mutation 'R2414:Tub'
ID250104
Institutional Source Beutler Lab
Gene Symbol Tub
Ensembl Gene ENSMUSG00000031028
Gene Nametubby bipartite transcription factor
Synonymsrd5, tub
MMRRC Submission 040378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2414 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108950338-109034460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109027033 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 259 (K259E)
Ref Sequence ENSEMBL: ENSMUSP00000113580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000119474] [ENSMUST00000207583]
Predicted Effect probably damaging
Transcript: ENSMUST00000033341
AA Change: K305E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: K305E

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119474
AA Change: K259E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: K259E

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 145 174 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
Pfam:Tub 211 453 2.4e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147943
Predicted Effect probably benign
Transcript: ENSMUST00000207583
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 C A 9: 121,908,974 S138R probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arfgef2 A G 2: 166,845,504 E216G probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
AU040320 A T 4: 126,868,691 probably null Het
BC002059 T C 17: 16,973,670 noncoding transcript Het
Cep112 A G 11: 108,752,582 N799S possibly damaging Het
Cilp A G 9: 65,274,645 probably benign Het
Cpn2 T C 16: 30,260,574 E103G probably benign Het
Cpt1b G A 15: 89,420,080 probably benign Het
Epor T A 9: 21,959,489 D365V probably damaging Het
Hip1r T C 5: 124,001,243 Y900H probably damaging Het
Hist2h2be T A 3: 96,221,434 I90N possibly damaging Het
Hoxc9 A T 15: 102,984,108 N251I probably damaging Het
Hpd C T 5: 123,177,524 probably null Het
Lrrc34 T A 3: 30,634,562 I197L probably benign Het
Msi2 A G 11: 88,716,547 V78A probably damaging Het
Myh4 A G 11: 67,250,768 I818V probably benign Het
Nol4 T C 18: 22,823,572 probably null Het
Plekha5 A G 6: 140,550,856 N362S probably damaging Het
Polr1b A G 2: 129,103,134 probably benign Het
Rc3h2 A T 2: 37,399,819 probably null Het
Sgsm3 A G 15: 81,006,745 N136D probably benign Het
Slco1a5 A G 6: 142,236,250 C583R probably damaging Het
Surf1 A G 2: 26,916,283 W13R probably damaging Het
Tesk2 T C 4: 116,801,757 W276R possibly damaging Het
Tmem8b A G 4: 43,673,892 probably benign Het
Togaram2 T G 17: 71,716,309 probably benign Het
Ttll11 A G 2: 35,979,534 S31P unknown Het
Ttll8 A G 15: 88,936,133 probably benign Het
Ube2o T C 11: 116,548,857 I162M probably benign Het
Vamp8 C T 6: 72,388,343 M1I probably null Het
Zfp503 C A 14: 21,985,964 G295* probably null Het
Other mutations in Tub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Tub APN 7 109021036 splice site probably benign
IGL02715:Tub APN 7 109029310 missense probably benign
grasso UTSW 7 109029650 missense probably damaging 1.00
troy UTSW 7 109020954 nonsense probably null
R0152:Tub UTSW 7 109020927 missense probably damaging 1.00
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0317:Tub UTSW 7 109020927 missense probably damaging 1.00
R1382:Tub UTSW 7 109030153 missense probably damaging 1.00
R1395:Tub UTSW 7 109020954 nonsense probably null
R1588:Tub UTSW 7 109029681 missense probably damaging 1.00
R1975:Tub UTSW 7 109027835 missense possibly damaging 0.74
R2047:Tub UTSW 7 109026732 missense probably benign 0.30
R2121:Tub UTSW 7 109026737 missense probably damaging 1.00
R3694:Tub UTSW 7 109027832 missense probably benign
R3695:Tub UTSW 7 109027832 missense probably benign
R4914:Tub UTSW 7 109020954 nonsense probably null
R5139:Tub UTSW 7 109011102 start codon destroyed probably null 0.53
R5347:Tub UTSW 7 109026771 missense possibly damaging 0.67
R5557:Tub UTSW 7 109025718 missense probably damaging 0.99
R6000:Tub UTSW 7 109029650 missense probably damaging 1.00
R6245:Tub UTSW 7 109027058 missense probably damaging 1.00
R6888:Tub UTSW 7 109029298 missense probably null 1.00
R7316:Tub UTSW 7 109030171 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTTCAGTTTGAAGGCCGGAAGG -3'
(R):5'- TGGTCCTGTCTGACTCAAGG -3'

Sequencing Primer
(F):5'- CTAGAATAGGAGGGGAGCTCAGC -3'
(R):5'- TCAAGGCTGGGAAGACTCCTTC -3'
Posted On2014-11-12