Incidental Mutation 'R2425:Gpr161'
ID250126
Institutional Source Beutler Lab
Gene Symbol Gpr161
Ensembl Gene ENSMUSG00000040836
Gene NameG protein-coupled receptor 161
SynonymsLOC240888, vl
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2425 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165295789-165326745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165310623 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 259 (S259R)
Ref Sequence ENSEMBL: ENSMUSP00000136621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111450] [ENSMUST00000178700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111450
AA Change: S242R

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107077
Gene: ENSMUSG00000040836
AA Change: S242R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 261 1.1e-6 PFAM
Pfam:7tm_1 57 337 3e-47 PFAM
low complexity region 476 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178700
AA Change: S259R

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136621
Gene: ENSMUSG00000040836
AA Change: S259R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 63 273 1.5e-7 PFAM
Pfam:7tm_1 72 352 9.2e-48 PFAM
low complexity region 491 504 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Upon ligand binding, G protein-coupled receptors, such as GPR161, activate cytoplasmic G proteins (see GNAS, MIM 139320), allowing the receptors to transduce extracellular signals across the plasma membrane into the cell. Phosphorylation of the receptor attenuates signaling (Matteson et al., 2008 [PubMed 18250320]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a null mutation display complete embryonic lethality during organogenesis, extensive craniofacial abnormalities, ventralization of the neural tube with expansion of the floor plate, absence of limb development, and caudal spina bifida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Gpr161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Gpr161 APN 1 165318803 missense probably benign
IGL01090:Gpr161 APN 1 165306580 missense probably damaging 1.00
IGL01151:Gpr161 APN 1 165321509 missense probably damaging 1.00
IGL01763:Gpr161 APN 1 165317251 missense probably benign 0.09
IGL03206:Gpr161 APN 1 165321649 missense probably damaging 1.00
IGL03279:Gpr161 APN 1 165310529 missense probably damaging 1.00
IGL03378:Gpr161 APN 1 165310508 missense probably damaging 0.99
IGL03147:Gpr161 UTSW 1 165317308 missense probably benign 0.30
R0367:Gpr161 UTSW 1 165317236 splice site probably benign
R1827:Gpr161 UTSW 1 165306567 missense possibly damaging 0.94
R1970:Gpr161 UTSW 1 165306358 missense probably damaging 0.97
R1991:Gpr161 UTSW 1 165306563 missense probably damaging 0.98
R4805:Gpr161 UTSW 1 165306460 missense probably damaging 1.00
R5416:Gpr161 UTSW 1 165321461 missense probably benign 0.00
R5546:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R5547:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R5824:Gpr161 UTSW 1 165310991 missense possibly damaging 0.94
R6152:Gpr161 UTSW 1 165310295 missense possibly damaging 0.58
R6658:Gpr161 UTSW 1 165306567 missense possibly damaging 0.50
R6924:Gpr161 UTSW 1 165321619 missense possibly damaging 0.83
R7128:Gpr161 UTSW 1 165310457 missense possibly damaging 0.92
R7216:Gpr161 UTSW 1 165306546 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GAACCCGGCTACACCATTTTC -3'
(R):5'- TGGCACTGGTAAAGGACAGC -3'

Sequencing Primer
(F):5'- CCATTTTCTGGCAGATCTGGTG -3'
(R):5'- ATGTGGCCCAAGTCTCCAG -3'
Posted On2014-11-12