Incidental Mutation 'R2425:Dhrs9'
ID250129
Institutional Source Beutler Lab
Gene Symbol Dhrs9
Ensembl Gene ENSMUSG00000027068
Gene Namedehydrogenase/reductase (SDR family) member 9
SynonymsRdh15, C730025I08Rik
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R2425 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69380445-69404533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69392964 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 19 (K19E)
Ref Sequence ENSEMBL: ENSMUSP00000069631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063690]
Predicted Effect probably benign
Transcript: ENSMUST00000063690
AA Change: K19E

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069631
Gene: ENSMUSG00000027068
AA Change: K19E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:adh_short 30 222 2.3e-41 PFAM
Pfam:adh_short_C2 36 237 1.4e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. This protein demonstrates oxidoreductase activity toward hydroxysteroids and is able to convert 3-alpha-tetrahydroprogesterone to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone in the cytoplasm, and may additionally function as a transcriptional repressor in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Dhrs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2267:Dhrs9 UTSW 2 69392853 splice site probably benign
R4573:Dhrs9 UTSW 2 69397641 missense probably benign 0.21
R4582:Dhrs9 UTSW 2 69397653 missense probably damaging 1.00
R4916:Dhrs9 UTSW 2 69401408 missense probably damaging 1.00
R5045:Dhrs9 UTSW 2 69392995 missense probably benign 0.00
R5048:Dhrs9 UTSW 2 69394400 missense probably damaging 1.00
R5640:Dhrs9 UTSW 2 69394478 missense probably damaging 0.99
R6342:Dhrs9 UTSW 2 69393187 missense probably benign 0.19
R6630:Dhrs9 UTSW 2 69397723 missense possibly damaging 0.53
R7034:Dhrs9 UTSW 2 69393176 missense probably benign 0.02
R7157:Dhrs9 UTSW 2 69393158 missense probably damaging 1.00
R7457:Dhrs9 UTSW 2 69401267 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTGTCTTTCCAACAAGCAACC -3'
(R):5'- TGAGGTTTTGGCCTTCAAAGC -3'

Sequencing Primer
(F):5'- TTAAATAACTCACATTTGCCAACATG -3'
(R):5'- TGGCCTTCAAAGCAGCTGATC -3'
Posted On2014-11-12