Incidental Mutation 'R2425:Rasgrp1'
ID250133
Institutional Source Beutler Lab
Gene Symbol Rasgrp1
Ensembl Gene ENSMUSG00000027347
Gene NameRAS guanyl releasing protein 1
Synonyms
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R2425 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location117279993-117343001 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to G at 117289450 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102534] [ENSMUST00000102534] [ENSMUST00000172901] [ENSMUST00000173252] [ENSMUST00000173541] [ENSMUST00000174770] [ENSMUST00000178884] [ENSMUST00000178884]
Predicted Effect probably null
Transcript: ENSMUST00000102534
SMART Domains Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
Pfam:EF-hand_6 474 502 5e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably null
Transcript: ENSMUST00000102534
SMART Domains Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
Pfam:EF-hand_6 474 502 5e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172901
SMART Domains Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.2e-5 PFAM
C1 507 556 5.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173252
SMART Domains Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.1e-5 PFAM
Pfam:C1_1 507 539 3.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173541
SMART Domains Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 441 464 1.6e-5 PFAM
Pfam:EF-hand_6 442 467 1.6e-5 PFAM
C1 507 556 5.77e-16 SMART
PDB:4L9U|B 705 756 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174770
SMART Domains Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178884
SMART Domains Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably null
Transcript: ENSMUST00000178884
SMART Domains Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Rasgrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Rasgrp1 APN 2 117305791 nonsense probably null
IGL00901:Rasgrp1 APN 2 117285130 missense probably damaging 0.96
IGL01083:Rasgrp1 APN 2 117285068 missense probably benign 0.22
IGL01325:Rasgrp1 APN 2 117298529 missense probably damaging 1.00
IGL01520:Rasgrp1 APN 2 117288663 missense probably damaging 1.00
IGL01776:Rasgrp1 APN 2 117286840 critical splice donor site probably null
IGL01780:Rasgrp1 APN 2 117284878 missense probably benign 0.00
IGL01859:Rasgrp1 APN 2 117289418 missense probably benign 0.00
IGL01892:Rasgrp1 APN 2 117293842 missense probably damaging 1.00
IGL02068:Rasgrp1 APN 2 117300578 splice site probably benign
IGL02684:Rasgrp1 APN 2 117282576 missense probably benign 0.03
grouper UTSW 2 117302004 nonsense probably null
Haddock UTSW 2 117291895 missense probably damaging 0.99
naejangsan UTSW 2 117291792 nonsense probably null
sea_bass UTSW 2 117282654 missense probably benign 0.02
venutian UTSW 2 117284929 nonsense probably null
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0538:Rasgrp1 UTSW 2 117284947 missense probably benign 0.42
R0786:Rasgrp1 UTSW 2 117300499 missense probably benign
R1068:Rasgrp1 UTSW 2 117282576 missense probably benign 0.03
R1165:Rasgrp1 UTSW 2 117284939 missense possibly damaging 0.49
R1491:Rasgrp1 UTSW 2 117282619 nonsense probably null
R1707:Rasgrp1 UTSW 2 117298547 missense probably damaging 1.00
R1869:Rasgrp1 UTSW 2 117290347 missense probably damaging 1.00
R2214:Rasgrp1 UTSW 2 117285165 missense probably damaging 0.98
R3236:Rasgrp1 UTSW 2 117291812 missense probably benign 0.00
R3915:Rasgrp1 UTSW 2 117288641 missense probably damaging 1.00
R4079:Rasgrp1 UTSW 2 117285029 missense probably benign 0.19
R4163:Rasgrp1 UTSW 2 117282654 missense probably benign 0.02
R4781:Rasgrp1 UTSW 2 117291709 missense probably benign 0.04
R4782:Rasgrp1 UTSW 2 117284875 missense probably benign 0.00
R5028:Rasgrp1 UTSW 2 117302004 nonsense probably null
R6019:Rasgrp1 UTSW 2 117291895 missense probably damaging 0.99
R6220:Rasgrp1 UTSW 2 117284929 nonsense probably null
R6294:Rasgrp1 UTSW 2 117291792 nonsense probably null
R6335:Rasgrp1 UTSW 2 117293870 missense probably damaging 0.99
R6948:Rasgrp1 UTSW 2 117298604 missense probably damaging 0.99
R7165:Rasgrp1 UTSW 2 117338404 missense probably benign 0.02
R7246:Rasgrp1 UTSW 2 117338354 nonsense probably null
R7372:Rasgrp1 UTSW 2 117285154 missense probably benign 0.01
R7400:Rasgrp1 UTSW 2 117298545 missense probably damaging 1.00
R7432:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7448:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7448:Rasgrp1 UTSW 2 117291697 missense possibly damaging 0.78
R7449:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7450:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7475:Rasgrp1 UTSW 2 117286108 missense probably benign
R7487:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGCTCTGTGTTCCCAG -3'
(R):5'- GTAAAGTGTGCCCAGGTCTC -3'

Sequencing Primer
(F):5'- TGTGTTCCCAGGCCCTG -3'
(R):5'- CTCTCCTAAGACTGGGTCATGATGAC -3'
Posted On2014-11-12