Incidental Mutation 'R2425:Upf1'
ID250150
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene NameUPF1 regulator of nonsense transcripts homolog (yeast)
SynonymsB430202H16Rik, PNORF-1, Rent1
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2425 (G1)
Quality Score177
Status Not validated
Chromosome8
Chromosomal Location70331525-70353278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70338460 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 544 (R544H)
Ref Sequence ENSEMBL: ENSMUSP00000148927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]
Predicted Effect probably damaging
Transcript: ENSMUST00000075666
AA Change: R555H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: R555H

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215817
AA Change: R544H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70338284 missense probably benign
IGL01890:Upf1 APN 8 70334230 missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70335652 critical splice donor site probably null
IGL03142:Upf1 APN 8 70333327 missense probably benign 0.04
IGL03151:Upf1 APN 8 70335387 missense probably damaging 0.98
R0270:Upf1 UTSW 8 70335645 splice site probably benign
R0477:Upf1 UTSW 8 70334080 missense probably benign
R0755:Upf1 UTSW 8 70334129 missense probably benign 0.01
R1018:Upf1 UTSW 8 70338906 missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70338403 missense probably damaging 0.98
R1445:Upf1 UTSW 8 70341524 missense probably benign 0.00
R1458:Upf1 UTSW 8 70344254 missense probably benign 0.00
R1511:Upf1 UTSW 8 70338505 missense probably damaging 0.99
R1552:Upf1 UTSW 8 70333059 nonsense probably null
R1560:Upf1 UTSW 8 70338442 missense probably damaging 1.00
R1562:Upf1 UTSW 8 70343367 nonsense probably null
R2082:Upf1 UTSW 8 70341572 missense probably damaging 1.00
R2143:Upf1 UTSW 8 70339354 missense probably null 1.00
R2423:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3031:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3032:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3123:Upf1 UTSW 8 70337483 splice site probably benign
R3508:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3747:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70339814 missense probably benign 0.30
R3964:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3965:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4152:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4505:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4506:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4838:Upf1 UTSW 8 70339368 missense probably benign 0.03
R5001:Upf1 UTSW 8 70334700 missense probably damaging 1.00
R5715:Upf1 UTSW 8 70352978 missense probably damaging 0.96
R5748:Upf1 UTSW 8 70338517 missense probably damaging 1.00
R5856:Upf1 UTSW 8 70334762 critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70344262 missense probably benign 0.01
R6010:Upf1 UTSW 8 70337025 missense probably damaging 0.96
R6056:Upf1 UTSW 8 70333037 missense probably damaging 0.98
R6870:Upf1 UTSW 8 70341561 missense probably benign 0.11
R7205:Upf1 UTSW 8 70340045 missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70340618 missense probably damaging 1.00
R7464:Upf1 UTSW 8 70333423 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTACCGCTTCTCATCTGCAG -3'
(R):5'- TGCCTATTACAGCTGTGCAG -3'

Sequencing Primer
(F):5'- ATCTGCAGATGACAGCTCG -3'
(R):5'- GTGCAGCTTTTCCCTGGGC -3'
Posted On2014-11-12