Incidental Mutation 'R2425:Il3'
ID250158
Institutional Source Beutler Lab
Gene Symbol Il3
Ensembl Gene ENSMUSG00000018914
Gene Nameinterleukin 3
SynonymsHCGF, BPA, Il-3, Csfmu, PSF, MCGF
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2425 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54265303-54267277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54265549 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 119 (V119D)
Ref Sequence ENSEMBL: ENSMUSP00000019058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019058]
PDB Structure
Solution structure of murine interleukin 3 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019058
AA Change: V119D

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019058
Gene: ENSMUSG00000018914
AA Change: V119D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:IL3 27 138 3.8e-41 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show abnormal mast cell development. Contact hypersensitivity is reduced and resistance to parasitic invections is increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Il3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0123:Il3 UTSW 11 54265680 critical splice donor site probably null
R0134:Il3 UTSW 11 54265680 critical splice donor site probably null
R0225:Il3 UTSW 11 54265680 critical splice donor site probably null
R1242:Il3 UTSW 11 54267103 missense probably benign 0.00
R4837:Il3 UTSW 11 54267257 start gained probably benign
R5521:Il3 UTSW 11 54267132 missense possibly damaging 0.91
R6958:Il3 UTSW 11 54267111 missense probably benign 0.00
R7366:Il3 UTSW 11 54265883 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTAGGTGCTCTGCCTGC -3'
(R):5'- GTAGGGCCTTCTCCACTTTAGG -3'

Sequencing Primer
(F):5'- TGCTGTTTTAACATTCCACGG -3'
(R):5'- CCACTTTAGGAGGGATCTGAC -3'
Posted On2014-11-12