Incidental Mutation 'R2425:Abhd6'
ID250164
Institutional Source Beutler Lab
Gene Symbol Abhd6
Ensembl Gene ENSMUSG00000025277
Gene Nameabhydrolase domain containing 6
Synonyms
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2425 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location8002902-8056763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8049857 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 215 (N215K)
Ref Sequence ENSEMBL: ENSMUSP00000153068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026313] [ENSMUST00000166497] [ENSMUST00000225234]
Predicted Effect probably benign
Transcript: ENSMUST00000026313
AA Change: N262K

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026313
Gene: ENSMUSG00000025277
AA Change: N262K

DomainStartEndE-ValueType
Pfam:Hydrolase_4 68 313 6.4e-17 PFAM
Pfam:Abhydrolase_1 72 193 3.8e-17 PFAM
Pfam:Abhydrolase_5 73 307 1e-17 PFAM
Pfam:Abhydrolase_6 74 319 9e-22 PFAM
Pfam:Abhydrolase_1 222 313 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166497
AA Change: N262K

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129169
Gene: ENSMUSG00000025277
AA Change: N262K

DomainStartEndE-ValueType
Pfam:Lipase 51 183 1.1e-8 PFAM
Pfam:Abhydrolase_5 73 307 8e-18 PFAM
Pfam:Abhydrolase_6 74 319 1.7e-39 PFAM
Pfam:Abhydrolase_1 98 322 3.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225234
AA Change: N215K

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Abhd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Abhd6 APN 14 8039849 missense probably damaging 0.96
R1757:Abhd6 UTSW 14 8049867 missense probably damaging 1.00
R2011:Abhd6 UTSW 14 8042742 missense probably benign 0.07
R3810:Abhd6 UTSW 14 8045603 missense probably benign 0.01
R4809:Abhd6 UTSW 14 8039771 start codon destroyed probably null 1.00
R5841:Abhd6 UTSW 14 8049596 missense probably benign 0.02
R5878:Abhd6 UTSW 14 8028286 missense probably benign 0.13
R6439:Abhd6 UTSW 14 8055589 missense probably damaging 1.00
R6582:Abhd6 UTSW 14 8042826 missense probably damaging 1.00
R6582:Abhd6 UTSW 14 8042828 critical splice donor site probably null
R6924:Abhd6 UTSW 14 8049850 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAATGTAAGTAGCCCCGCTC -3'
(R):5'- CACTGTTCTCAGCTCAGAGAG -3'

Sequencing Primer
(F):5'- GGCTGCCTCGTAATCTGTAAAC -3'
(R):5'- TCAGAGAGCCGTGGCAGAC -3'
Posted On2014-11-12