Incidental Mutation 'R2425:Fam35a'
ID250165
Institutional Source Beutler Lab
Gene Symbol Fam35a
Ensembl Gene ENSMUSG00000041471
Gene Namefamily with sequence similarity 35, member A
Synonyms3110001K24Rik
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R2425 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34237033-34310493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34268689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000153771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111917] [ENSMUST00000227006] [ENSMUST00000227375] [ENSMUST00000228337] [ENSMUST00000228626] [ENSMUST00000228704]
Predicted Effect probably benign
Transcript: ENSMUST00000111917
AA Change: S87P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107548
Gene: ENSMUSG00000041471
AA Change: S87P

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
Pfam:FAM35_C 694 866 4.6e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227006
Predicted Effect possibly damaging
Transcript: ENSMUST00000227375
AA Change: S87P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228132
Predicted Effect probably damaging
Transcript: ENSMUST00000228337
AA Change: S87P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000228626
AA Change: S87P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000228704
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Fam35a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Fam35a APN 14 34268625 missense probably benign 0.02
IGL00962:Fam35a APN 14 34249251 missense probably damaging 1.00
IGL01288:Fam35a APN 14 34259643 missense probably benign 0.00
IGL01302:Fam35a APN 14 34259727 missense probably benign 0.03
IGL01312:Fam35a APN 14 34268193 missense possibly damaging 0.56
IGL01444:Fam35a APN 14 34237557 missense probably damaging 1.00
IGL01633:Fam35a APN 14 34249179 missense probably damaging 1.00
IGL02251:Fam35a APN 14 34268278 missense probably benign 0.10
IGL02927:Fam35a APN 14 34267701 missense probably damaging 1.00
IGL03183:Fam35a APN 14 34245186 missense probably benign 0.02
IGL03226:Fam35a APN 14 34268371 missense probably benign 0.08
R0111:Fam35a UTSW 14 34267729 missense probably damaging 0.98
R1170:Fam35a UTSW 14 34268491 missense possibly damaging 0.92
R1348:Fam35a UTSW 14 34268923 missense probably damaging 1.00
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1538:Fam35a UTSW 14 34268876 missense probably damaging 1.00
R1602:Fam35a UTSW 14 34267650 missense probably damaging 1.00
R1650:Fam35a UTSW 14 34259617 intron probably benign
R1777:Fam35a UTSW 14 34268173 missense probably benign 0.07
R1843:Fam35a UTSW 14 34267803 missense probably benign 0.01
R3837:Fam35a UTSW 14 34249185 missense probably damaging 0.99
R3838:Fam35a UTSW 14 34245368 missense probably benign 0.01
R3904:Fam35a UTSW 14 34259709 missense probably damaging 1.00
R3964:Fam35a UTSW 14 34259687 missense probably damaging 1.00
R4322:Fam35a UTSW 14 34259675 missense probably damaging 0.99
R4708:Fam35a UTSW 14 34267833 missense probably benign 0.17
R4771:Fam35a UTSW 14 34268706 missense probably damaging 1.00
R4838:Fam35a UTSW 14 34268625 missense probably benign 0.02
R5448:Fam35a UTSW 14 34268370 missense probably benign 0.32
R5874:Fam35a UTSW 14 34245258 missense probably benign 0.08
R6332:Fam35a UTSW 14 34268172 missense probably benign 0.07
R6333:Fam35a UTSW 14 34267608 missense probably damaging 1.00
R6476:Fam35a UTSW 14 34268014 missense probably benign 0.27
R6576:Fam35a UTSW 14 34268242 missense probably damaging 1.00
R7172:Fam35a UTSW 14 34237568 missense probably damaging 1.00
X0009:Fam35a UTSW 14 34245186 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGGAAGTTCCGAACGCAGG -3'
(R):5'- TCCTTAATGTCCACTGCCAACG -3'

Sequencing Primer
(F):5'- TTCCGAACGCAGGGATCTGAC -3'
(R):5'- GCCAACGCCTGGGAAAAAGTC -3'
Posted On2014-11-12