Incidental Mutation 'R2426:Kcne4'
ID250182
Institutional Source Beutler Lab
Gene Symbol Kcne4
Ensembl Gene ENSMUSG00000047330
Gene Namepotassium voltage-gated channel, Isk-related subfamily, gene 4
SynonymsMiRP3
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78816758-78820028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78817971 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 112 (A112E)
Ref Sequence ENSEMBL: ENSMUSP00000055415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057262] [ENSMUST00000187432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057262
AA Change: A112E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055415
Gene: ENSMUSG00000047330
AA Change: A112E

DomainStartEndE-ValueType
Pfam:ISK_Channel 4 86 2.3e-11 PFAM
low complexity region 124 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186681
Predicted Effect probably benign
Transcript: ENSMUST00000187432
SMART Domains Protein: ENSMUSP00000140235
Gene: ENSMUSG00000047330

DomainStartEndE-ValueType
Pfam:ISK_Channel 6 64 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189296
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the embryo and in adult uterus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Kcne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Kcne4 APN 1 78817808 missense possibly damaging 0.89
IGL03047:Kcne4 UTSW 1 78817778 missense possibly damaging 0.64
R2091:Kcne4 UTSW 1 78817907 missense probably benign 0.00
R3405:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R3406:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R4158:Kcne4 UTSW 1 78818102 missense probably benign 0.01
R4159:Kcne4 UTSW 1 78818102 missense probably benign 0.01
R4414:Kcne4 UTSW 1 78817934 missense probably benign
R6959:Kcne4 UTSW 1 78817886 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCTGGGCTACATGAAATCC -3'
(R):5'- TCTGTCAAGTGTAGCTTACGGAG -3'

Sequencing Primer
(F):5'- CTGGGCTACATGAAATCCAAGAG -3'
(R):5'- TACCTCCTAGCACCTGGTGG -3'
Posted On2014-11-12