Incidental Mutation 'R2426:Plcb2'
ID250193
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Namephospholipase C, beta 2
SynonymsB230205M18Rik
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118707517-118728438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118715649 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 555 (T555M)
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000006415
Predicted Effect probably damaging
Transcript: ENSMUST00000102524
AA Change: T578M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: T578M

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129153
Predicted Effect probably damaging
Transcript: ENSMUST00000159756
AA Change: T555M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: T555M

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118718889 missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118713734 critical splice donor site probably null
IGL00851:Plcb2 APN 2 118728251 missense probably benign 0.30
IGL01765:Plcb2 APN 2 118710268 splice site probably benign
IGL01837:Plcb2 APN 2 118711926 splice site probably null
IGL01868:Plcb2 APN 2 118709590 missense probably damaging 1.00
IGL01868:Plcb2 APN 2 118711387 missense probably benign 0.09
IGL02158:Plcb2 APN 2 118711363 missense probably benign 0.06
IGL02447:Plcb2 APN 2 118713155 missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118719760 missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118710963 missense probably benign 0.00
IGL02723:Plcb2 APN 2 118717019 splice site probably benign
IGL02929:Plcb2 APN 2 118713234 splice site probably benign
IGL02949:Plcb2 APN 2 118719109 splice site probably null
R0031:Plcb2 UTSW 2 118715461 missense probably benign 0.36
R0157:Plcb2 UTSW 2 118718541 missense probably damaging 0.98
R0366:Plcb2 UTSW 2 118724447 missense probably benign 0.01
R0376:Plcb2 UTSW 2 118717240 missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118717325 missense probably benign 0.32
R0790:Plcb2 UTSW 2 118712483 splice site probably benign
R0893:Plcb2 UTSW 2 118725105 splice site probably benign
R1647:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1648:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118715687 splice site probably benign
R2210:Plcb2 UTSW 2 118717503 missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118723534 missense probably benign 0.05
R2251:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2252:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2253:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R3970:Plcb2 UTSW 2 118715690 splice site probably benign
R4007:Plcb2 UTSW 2 118710793 missense probably damaging 1.00
R4162:Plcb2 UTSW 2 118709587 missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118709566 missense probably damaging 1.00
R4422:Plcb2 UTSW 2 118712003 missense probably benign 0.28
R4772:Plcb2 UTSW 2 118713134 missense probably benign 0.20
R4795:Plcb2 UTSW 2 118711124 missense probably benign 0.32
R4935:Plcb2 UTSW 2 118718915 missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118712136 missense probably benign 0.01
R5055:Plcb2 UTSW 2 118718222 missense probably benign 0.06
R5452:Plcb2 UTSW 2 118718246 missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118714729 missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118711051 intron probably benign
R6284:Plcb2 UTSW 2 118717301 missense probably benign 0.37
R6380:Plcb2 UTSW 2 118715468 missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118719173 missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118723690 missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118719441 missense probably damaging 1.00
X0024:Plcb2 UTSW 2 118712375 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGGCATGTAGTTGGAAGAGTCC -3'
(R):5'- AATCTGGCTGCTACTAGGCC -3'

Sequencing Primer
(F):5'- AAGAGTCCATGCGTGTGC -3'
(R):5'- TGCTACTAGGCCCTCAGAC -3'
Posted On2014-11-12