Incidental Mutation 'R2426:Atg9b'
ID250206
Institutional Source Beutler Lab
Gene Symbol Atg9b
Ensembl Gene ENSMUSG00000038295
Gene Nameautophagy related 9B
SynonymsLOC213948, Apg9l2, Nos3as, eONE
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24384181-24392143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24386994 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 669 (I669N)
Ref Sequence ENSEMBL: ENSMUSP00000051864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000059401] [ENSMUST00000115090]
Predicted Effect probably benign
Transcript: ENSMUST00000030834
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059401
AA Change: I669N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051864
Gene: ENSMUSG00000038295
AA Change: I669N

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
transmembrane domain 279 296 N/A INTRINSIC
Pfam:APG9 321 681 1.2e-100 PFAM
low complexity region 782 799 N/A INTRINSIC
low complexity region 838 847 N/A INTRINSIC
low complexity region 854 871 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115090
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156403
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Atg9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Atg9b APN 5 24386515 unclassified probably null
IGL02020:Atg9b APN 5 24391058 missense possibly damaging 0.89
R0045:Atg9b UTSW 5 24387398 missense probably damaging 0.99
R1698:Atg9b UTSW 5 24388188 missense probably damaging 1.00
R1807:Atg9b UTSW 5 24387057 missense probably damaging 1.00
R1885:Atg9b UTSW 5 24388254 missense probably damaging 1.00
R2183:Atg9b UTSW 5 24390493 missense probably benign 0.01
R2224:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2226:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2227:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2919:Atg9b UTSW 5 24391544 missense possibly damaging 0.66
R3003:Atg9b UTSW 5 24391219 missense probably damaging 1.00
R4772:Atg9b UTSW 5 24385239 makesense probably null
R4786:Atg9b UTSW 5 24386089 missense possibly damaging 0.92
R5901:Atg9b UTSW 5 24392019 unclassified probably benign
R6410:Atg9b UTSW 5 24386110 missense possibly damaging 0.46
R6505:Atg9b UTSW 5 24390577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTTGCTCCCCTGTGCAG -3'
(R):5'- TCTGGAACATGGGTCCTTTG -3'

Sequencing Primer
(F):5'- GTGCAGTCCTAGTTCCTAAGACAAG -3'
(R):5'- AACATGGGTCCTTTGTATGATCTC -3'
Posted On2014-11-12