Incidental Mutation 'R2426:Olfr777'
ID250234
Institutional Source Beutler Lab
Gene Symbol Olfr777
Ensembl Gene ENSMUSG00000062914
Gene Nameolfactory receptor 777
SynonymsGA_x6K02T2PULF-10955551-10954616, MOR114-9
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129264407-129271485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129269266 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 19 (Q19R)
Ref Sequence ENSEMBL: ENSMUSP00000145475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080313] [ENSMUST00000204573] [ENSMUST00000213512]
Predicted Effect probably benign
Transcript: ENSMUST00000080313
AA Change: Q19R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079191
Gene: ENSMUSG00000062914
AA Change: Q19R

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.4e-42 PFAM
Pfam:7tm_1 38 287 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204573
AA Change: Q19R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145475
Gene: ENSMUSG00000062914
AA Change: Q19R

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.4e-42 PFAM
Pfam:7tm_1 38 287 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213512
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Olfr777
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Olfr777 APN 10 129268523 missense probably benign 0.18
IGL01782:Olfr777 APN 10 129269039 missense probably benign 0.00
R0554:Olfr777 UTSW 10 129268499 missense probably benign 0.00
R0594:Olfr777 UTSW 10 129269152 missense possibly damaging 0.95
R1792:Olfr777 UTSW 10 129269243 missense probably benign 0.20
R2357:Olfr777 UTSW 10 129268773 missense probably benign 0.31
R3757:Olfr777 UTSW 10 129269065 missense probably damaging 0.99
R3758:Olfr777 UTSW 10 129269065 missense probably damaging 0.99
R3962:Olfr777 UTSW 10 129268666 missense probably damaging 1.00
R4600:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R4603:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R4611:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R5113:Olfr777 UTSW 10 129268666 missense probably damaging 0.98
R6415:Olfr777 UTSW 10 129269021 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCACCTGTTGAGATGTTGTATAAG -3'
(R):5'- GCCCTTATGTTTGCCAACCG -3'

Sequencing Primer
(F):5'- TGTATAAGTATCTGGGAATGCAAGC -3'
(R):5'- CTACTCCTGGACAGATATCTC -3'
Posted On2014-11-12